%PDF-1.6 % 102 0 obj <> endobj xref 102 28 0000000016 00000 n 0000001538 00000 n 0000001620 00000 n 0000001746 00000 n 0000001940 00000 n 0000002089 00000 n 0000002956 00000 n 0000003613 00000 n 0000004449 00000 n 0000005135 00000 n 0000005397 00000 n 0000005672 00000 n 0000005775 00000 n 0000006057 00000 n 0000008761 00000 n 0000008920 00000 n 0000009156 00000 n 0000009295 00000 n 0000009894 00000 n 0000059799 00000 n 0000060060 00000 n 0000060933 00000 n 0000109309 00000 n 0000144218 00000 n 0000145795 00000 n 0000168852 00000 n 0000199465 00000 n 0000000856 00000 n trailer <]>> startxref 0 %%EOF 129 0 obj <>stream xb```U <\ B  cc`a$ }701Zta^ kM槇p3n````z0֩)KokE (8k0Qdr`aϳk. \ csS# ,iاtEʃԣ6Y882eL ?@0P, 2Y)EY|]|fr<7 "9KW,qH6ϣLzg@_q*G$>y l#k ɥoC }{C,ͣ6QS'5Lj+]W(]B;::@iDTHP Pr H3 i@ՙx@X# ,fccc H4% r(%4-JJPkh(E pơi1L7RSP[d5bM/0i1ergϰ(KAá.yL{&c=\a)* ;ϔ.ð:at"s?pT|oP + endstream endobj 103 0 obj <> endobj 104 0 obj <>/Encoding<>>>>> endobj 105 0 obj <> endobj 106 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 107 0 obj <> endobj 108 0 obj <> endobj 109 0 obj <> endobj 110 0 obj <> endobj 111 0 obj <> endobj 112 0 obj <> endobj 113 0 obj <> endobj 114 0 obj <> endobj 115 0 obj <>stream HWr}WG0f_TR$ S2E6j @>!oCR|\#9 J9R4Nso{iGѫ"&Q^蓋 bͼu|?hQ\ڌ^}v1tqs9|Ag^깮߾ρfsqŷ#u2S 0$  oBS ɐf'ٜG6Ejѷ\'> 42% ,Ga9~xxS'<Č̳EN5qn0H_rt 4,FdY$ ZwwtKR-#/BnFAcg?\_͌nz7: '"$t0v=Vt˶kX޽S%tt^&-uh];*V&-ĚN}:{ֈo^J#o*Izfb|?lYGݖ?jy]bm:VPh0GN b }VLj aC-hoZޞN661Y Ϣ250Q! d+V<^pX'jm9QNFqEk-09St+,:U0&<N;4Ϸul_VtV,065w%/ڶ$*j=oPءxQxEid|7l^"(lKЯ|$@yNmoL5U]rR% % lO\? ^@xVK%PV<(E|ްjwCeP|]2"o4x[u6li:Ji5;9us2ʹ +S袄L bza@&jycʕ+&\+/xYjC릖ϥ!j8ϹeRY S,4\κR*9{KkV 4 lKceK:>His|pW^P?:-DpXaEv@ؾn:y R"-/X} qԑƖ|+JΥXg5Q΃o $GD @8yɻ9@<7^ ^d z'ˎ`Nh'Mi%SY^t%DL`088=ͪ}>>% ~S<'-,l mbxci71ent U(zE#AQiO x`͎ItlFқF*|y'q( Bڨdk ܊'m#3S\;GS1Z!ah@-+1'qc>N4`z`M6tVJ!k uOYF$'`WΠ Ҥ}S/ ^*J'F0:Tr)3ہGiXpTNM<5 8%`aF~lmiin&K|CF)`O|/ L=yl(ul~hj&+jZ'}:2D2_%̣N`q ԁv$/F_iLQ ~]gd P\|ä;MOH8Dr .]u& '0e7TiY{. A}?y*n..sDhJd-̱^`Ev\$!` C=ʞ:X\ B_.{G}?Lhp1kץoQ1ÅC{O@ٯs6B{ ax짮[ͥKp5ᭉa<'ڐ=zx17?u6~2y>iCI ]y, O3 P;1^,FؾH~|rrjxƙ5IA0,NY2cS*LA\Os {X``G?Pݳ4y;}oנTqe F$swCٱRE؎vY#P8/R 0+(j[sK,][h7ilSLEamƍltԏF썑gv LM Ɓs,1, 4W ̜ }uoSp\ԕ ֖g <J0)ehl.Iq̜̒<`X =#S#,4*A>GDch x`\#g 3̀40/JĀ9 D_ ԢI y(E90N30F' Hd endstream endobj 116 0 obj <> endobj 117 0 obj <> endobj 118 0 obj <> endobj 119 0 obj <>stream HTTM0+|jc EHlTvդS!ynx>fq}~<]n>+Z{HtYsm&ΧmFFx[xWzDurN9ݧ闽aR謋K37W+Ώ bB%cgoSc +R\?RءQ֙WJ+RR3Z?r$ $--Q., 4gQ!lO͞MWD2sr9Bv dGLk!uZRΣDc&ĵP7JRrAUU,?BCgck [d J:C֐" ڂ'XF52 .pe~^&w s\i-Hu1 D )Ę*BPPDk= [/2)DRH!Qd(>+@3O0 yh>?}6y^Wd`O4N~]/-5 endstream endobj 120 0 obj <>stream HdV{lv|/ca;{ DƎ T6GS1 EBD(hIe) A) ji+Bh+h$\K9=7{7ov},J0(j_lH__w hMoWwpoǫ{ldi\~{f>]սS+Yk^Kߝ6m=_- !Ds+# [{9@:?LUv9<#=}zU2el gAۻFgXq` TVgZ}H`u{Rn>ϵr#bSA!(D2 LxY2: Eh. U)~ +2P 9ƒVA}nz9$+?P{Dr<@ْ_dRpz[p;09ys0i)ɔ8W Ův7_EA$god,Iu˨7x$NҢ2I{qw̟t5_IoJ{p14tu)?f<@:vxйK٩}ec'k5 RRBM~E CĹު8Y %PQ@M).ɍ+QeD`bFZOC$+n`7SKeة2oĆmؗɪi6c>Kx%v%^Ag ~MsRJ[hMf0ALn2qb$z6+K ^֮7",Hu܌$扻S MksOî%Hg;my';=Ĕ(̊M nkl kf;+ jm9]l7J=&mcKKʐ1Z{.xUCX<NjTnZ BL{JF-g3eaH̜]FEydXd$wҺ:-h 3N>D#@u-ZHhH%3`jjPg-[]MlhǨX.%>HzHSޙ]c-XǹоbY`}jVH(aZ덩t8S +JbA#E d V 5 @i2d=e`^wAza49#cp8lz,>M+X}%}<{ڍҀcm{dރ/,kyuN;zfGCuI2cOVuF}ޖo,-<omu!M~Oj9î$a%ߧ;O9+9<=짞woLAӔr?ZLْ4 mIɓL6*` ѡU4.;&<UU@hs}=Y§sH޶x/)OqRrE|ހ[b؈z"dUnbZ[=VȑI&\tv9L2t8fN "7|sj/^ئ{z'a{8%Xi[7a䮉?\+LccN=.<=S#B R l5@-ptz[T۹fvMPD`31I.pvc$ Z DHe$Var pToIJ[ YX̶YQ^kspBWdzq8@k%-de 448PDjeR-R;>ds%ː/J|H;|!«>{g'~}yIs;qwc;'NBѠy*[gPLZUvbuLjҶh*HhjEˤ ֍L!!l+޽ :M}=,w~)BC* ҽ\XYҀCEZcm/Hy٪ag̳Ԃ3}O,F=/_+]dp8 Bae#{cd)*]t)w4F19l>_ʒVfsg1j"ꆡ.A@#MUc=Bnب ,^6` Ƅq̘3 QDaAml̍F4JO~ 'Iw' w, JX̼T^ i&u:riM_'}pSBtk#Za~kWQ "MVvG)=w>|;|Qޱ=6Ɯh?e޷yl:Q" ESqiO}A+FK;{T1\”0/*$˜Mmf9&mgP${e }JmDӷY}NG)_9s eꗡl l\=: *4ZfN_6ϖ|?[[hۭh[zWmM?”c)#U<9A؋y={Ϲψ³]qB/YAGwœ33#/&E-y9/`.)Ns5 Mאkap'u*}eFW=`nvRt:IQki;N_h6ypHQ mj?X(}' f)ZX:5놩qYݮ:~1=ҟS!G z<0HABa(i{Q]US Ok&Rfp? İ,;r=)p@G,qLDS"<.Beu^^qxyZ3/t`geQ>'>a*y!jһM@:X:?uK$u| q'PyrasU=?O|I݋C;$Rƒ<Hk OГ|7{Bbw7&LQ-r7zW\^3q֠o*Kzt .{S ø5 [^,~n,oҖxFahhMWըsޡQGG5/ E{ۼvR8~Ϛo5x"I[/%9l n%6'vY%@>9{2\}/Q: xKO~,gO\|_W?H19yO_+|\WS5A7xPE jX16 `eAebbe.7(\!@*]F8ӏN}J$D+DXEL#cj4e 4JJ^_E+`(ye7~aᛖ76.Djwٸ?|D$KI4pOsłʌӼ-7ey>_w/g_|vp*V ,t(DbtMPXmՕ Ƥ6ʂ`JKFjZ7HK$U^\´VsO)>PR^O@0'$p> e0&kx.gxm0`{sOiG*`O KsVʌ"":. RO@ E~CkN;pބ;Ooa:4A³"_;LIP] P"ݞ傷Hlngt'_"[$?sV$>w"]8jP *?O10, e)r)!C u. tWe}Tu?86ZF+f?4o7$7#8{4gzvcp5-ĸ:gĤ 2FgLWWz\8kЊVɊ]G6,WVUWq#_QjHP;Ψ-5 &dSd-j1_`"Bt]Ph!/QK]\<`kտ]xM^ǡ̓k6ꍮڕڏ&B3I$6KH#_|ZF_WWep~4%VJF?j y\_Fky?^|F8Rbq( $!;$@5PJreu'f78_Ƨ}f_FKG>Mk5FkC0NqM! WS<9ڰs0ʫcR ƥ0J4!]#'-,Dd{Y ro>K$X$#wbPB@C}F@G$,=]4Q97Z#f?*wh_O/hfSڮ6a=wCB_i'8ANfz1녅#<߀Pg(9aGۜ4#^;~e_tbuW<$۽{c/?t\?׾U|kJiJғ_7zzG@8x00(ZҡR't|D7X $ [izʬGF朖"Qq2)>9iV#fIi>:_ I_.79/8w6\.9!-P݀qYj7BzS(e~5[| `*aS7!/hLʪpǞ.]OG{~`2E.C.,! Ww]me ׅXFr*AK8J]6RH+ |fV|c>Xy|{h{5|xզ.] a-0 GPYH ?۶q: ͛70 craԖUO:! $%ݩQ5ɟfr//[0s RnIYR?\?IY˵m?ZZ4I=_4u)f њT3k7k AY*K:ږƈESf\\;29j "R+RI&ǮHĔռvgvB*۲RΖdBV29,ȢMh3b|E+SeWS)_Bj *YdT@`آuҰdtHQ̆ lU*Da|o  !Eh> ES'^!MIߖIy%s~R_TݩBTǯ4X1n, /g@pu@dc,p0;2&ktؤcd =q_9 ;9wnSؾ|Ӓ vYqA/;h%KU-diބ%L74 Ӆx|y=|(Á@CM(b~nD8lE".ςKZrGa5MXnNAkeJ&7!L5o7‡_=q%7׫ZT'$w}f<OT1ll]GѨ #0bqC3ᛇ/ >&.wcKLt_QtlNcCf%s|p|zؼ֓Wr̯]] s=?;m6P97z޳,yvǦtegb;J /]5 u@~?.YS>ƌֹXYNEj^0\WҰĶMhZC{McE_hz{(w1Dgia b?+ %=YUˆ_?|4A۷0B!8y&xucCo%iB!O@Q7џɩCiu{_s3H_16wnc:BߘRSftjdejM.(}}=Z[/} eI_B :}:쯄*z)ze!qbNOv:r~mD๶+"\l }>b>@ ADoA.r2ĘÜah&iDȶ $ğ#Gm+[Wwƅݺ up"&ٵ|!@(<\| F)Fe(+{Ód_cuO=RTM0ӿbZo*ХQs{b51#[9MEqXbB%DR'YJ A'[Xwf E )R,>wQc^n9x/QܵqAfh€Ea4qao \0]^_nXmz9ĥ_-$JaD]&XĎ |Ǔ!gf%tà P)ҼSa uC@8ꑍ/2XLLVd)sD"iB2mi$4QKωi!eP'M\뽽?2@OEau-pr]Qgxfn?w{{_k N)nWƀ\R*>U[Q_iHFJVmVH n]B$*W*Vj}3;;3<!p=ܖs]#mUm]_޶15U@a}iM;z׾0Xԁ:{zZw~qdcT }sӋ_]v܃g!`Io<G. ,W-(esLY$[g"Qn 4 <gɸ0p)pcM/J\*3vS罇dҜ[h,{t 2ړ-SZ&Rτ-ѓoзy|ҵGM"pC]g32O. l$OjҲ9irTM6q]UY3Es\6jkm:X}ad^vwLIY"26pđ741KnxYDP^xq/ƮzirRVŁzhw-FF}AQ.UƀE}}}VP"&Э-N0{.xUա X=6F+`,\bv&hP#/ҙc?(ޘ5eg^ڻm}/}ϩp2UZ;I};5HS+KZ4FA@QX0x)nP6#D̕! 7 ADm!ȉG O~›EOm#j@d W칮9fc_$9?7ؿh|Q9<6Uk"O2'D w=g<<~J h4ub lPӂ&EɤCl>Rs,ZX\K%fyo</r)8R榜 78+ePX}#e#I!..eiV7%%\\Osc:y3EޞrTd*IoV:+|?rK(R".\Kܻ*lZMħR)3Wc22 EZSk\3 dl<[5_&NL;q#"ѣF 6d>{L·wcW[7rx'=_⻧7_%}w6i4i"_wS>tD2<&?3C,duf%/FI6leC28D!"X? hҒTAuumB0TH^NP!Nmܳŀ}Hv>O؂IWeRݸ=% O_fTB"|9xpPU\ i77'#>LjРA c | 7t0tؿ6ϼmVVO~n޴F@@ ə@>1öCn?RSi%M+!СK0G+*%o Floy|# f"ҩb:+4f;;_{ v=mƃq~BX˽梋+RPۉ$ɃZi |ќh:KM kDgu"BZ-@?"!IqnD\`H,~HTZj'`GLD_]]j~ 8E *F y,0yIc]"F-Mx0'1$!'i6iII@uSg :{b+ =,PLWb)e]YhzLEQeWwqX.EuY< ZQ\H0WuIY>Z-+j2խtvWltaSd{ֲ`P5k9*њDp~%yYnZ:2ְU-ϤUjO,,vG^]Mwvg^vwvαa'v2awH1%]ѦVtB UcDNR6UxQ6XQ&։?m-$=4<|~|}R8OTT5VI*!pHɊʸٌV\Z.: $mA!P$[0"COv\UO8یs!±>%>30^#ZP@>WƷj"AkshG<ް}F M;q&P!a+O O(/<c/“,9ePʇyrkJcDqa?*YVHi bq#yWߡ˾>7mn|;&\{ %(4iKhwq72zAk E]va'39I@% .녁3٭g<_t`7}uE??Mp5C4LT)o[?"Cr&Eg]\% a@>) 4>fR 6/H Zm8^zw x@ݫMxu 9_Bq8s'Eo'V5 ^OSWz+uw|C~5OCw=Z{oo9Lܝ\YT\ZZXJR)Ʌ(^4qY#kbM&[٠[oU)f}u".L!P'8lUjÕ؂OXKDz*{ aM*xq+awD!!H'yۄE!5n𓮉mgDKu XՇ~֪I|J<&GloҸ/?Te~T2ٜ2sz3+EYAKr!˰E'U { n&wc4AinI$fQI1y&9t%W~8]H\XU\pD&(QYZ x3]rOD4_zIQKkqL%G#ZRx+6LI2qJ#k<=w7e˱B1+ ~gG|.g~Zሰl3=AQg'z<<ʡ'yO(2|AZ΢↝9K,.D0{ؘf܃קJR;{LtYphGx8y# N)ǎ,.ZKq|^ "b&cяuΤg2J}ndonoټ\ q8ӌ4f8x1 ߝ:/ &5ONp'ͷRoyڛʎ~Hӕ37G.:2P h QSHsfhHLsxQŋNxVHb)CQjTUb;h X!J'v #„SQ-M-^'-4lXM1n. *#bp<M~cй$jԫ% [7`b;1؁Np   L]ocHlnd{E ubl0E1ds>=5—.Sڶ?y?{rt(ґNi-'(H~ו֟^#odx˿g ~B:0v)0 jUEQ}6lBX0&/+\Wl31*Gq//rQn'S%5; 뫦IW2#|:iZ?X.޿om?et]\;=.f;ї7bX[}pm7Oi1\p=ZQ*ݝG\w@ s哢yAC1zΜӵkLJ, Ldw/A PqY $q5wi q@ot[NnWܖܩUpo&ĉD5ߴ0-^Vnɀxu bgP9X׳8  ynT gH P.-Bb '7-]QTP:FRe9ϧj\դpQb^?1(j3*3U+rQOQhWqiϗjjU ~$GʆrE]a]qb I$"[pq>L&X?a.h80RJ /Tm@]Vd`*mȇpZ0f1=ʸ|#PI/WL&j6ͱ&V 3RM"A1"7ty`EƋCaIbZ&ΥC|9yybyFGl6Mx+P,Z@-Ɗ!6PP62 r$)ՈW͓Ֆo-Z߿[>P`J`nvg"M1ߺ~ľ.jR= %4ͥtܚ=ɕHs~bP٬'83[\+L%k ci t* &qERK%pZ2̇mIDH=_%$C2-_c+`CɕBO=x$ZLVFusפjlt9>~?z$v4w>ÞQOE;;ϞW/K̯ѝG Цe1 ZVIJt:F}l&L3A<e, MgdI"`b5+W" `ǦX!Rg.ve1.f4`'{| i`p1Q9\]枕扡Js bz~CfN6d$|%y sP@C;jOIT&|Lc _?~;ϧ?\}t{nQ[]}iMnniӪ)C cUCJ:عoFB/!{CTs e]w)Q3K13~jhe=<šft8#S_k]ƣQrNx,ġi\ToOHXB{Uea0sЈ2rRV?mnZ*6`')OyF>om<ޝc۱}gN.9v05&`I)`*U Zit (kQm6ul|*26&UjݲvRYV8*͉wƕ~;s=ռFp0{|[ /apCrBzi8ڒ J_VOm'D+ՊTі-L9qUw# N[Fl~ak#AN%Y/ 3U|_DRK;vz$O*?Fծв/k؃g4W xM O %,M"x PA-Bdt# ERAݶU$x=_[P[)(ug ƝT9k6uK)X@mEB';(6_aVٕjh0 =kx7qANȐIt !7[Iԫ4kenAHDa6׼ i?%'HIjܽ^:: kuqMjbb6qF2BKZw9iŪ[ݦ6Pd&1úov;dfEo(9^f8(2k%қ6J<)ȓD^)㮪k ."E*r4(~?QEJ](s}U81qn US}*_RZYI:n=-)Zݗ? %!T{O[Z!1q ݆G ~NQ-'8ow>p:#O8 -EE]ٔ;keg |(zCC:*rQ\^hZDK#"D4JvO?% vnRNR(l$++>+*sm]P(+IRG 썙C߿'GMŇ}[R|ҘY_К .%j>? z|9@^5n.+ͥ[%|%R  xA1'ȏzv =' ")j]R,`Gk,,E0 rEmm.ґz_g")z.D&2WGܰ U2EU]GHr{dáv:D^srYВmx$%# b,;& /v$$=7o~wGXkq ny ƥ74*[; a?5Cg`H! AubE|m}9r @a!%^+{;}=P/7 Ay)jR,P0.-A1!aiSMUqLoCY>K貈'*vjÚU|y#jJ>>IJv xvhϖL @  i+_:{aeac %PqF ief28 J/,SfS#l8TF GCfMfߦ,KlHqk_H,սx'ƻ#m=]51oOC#E @~B8IŁ::ץuzA]Ί۝A,la8x,N{G7AXJNzsp<8p?5`0sހ{nw_O׮BKkkkU2PsmjܠNj%1nnUf(g?2B`#wg[,qO_9`dKs54M߀Lÿ4K2pY ň|x+sN6)p%b=ەu>^2IJ4xs]5@Qg۽~]ݻ;D R`Fќ2"gjlK5Qĩ3j4?5)JǨ36I[kZ͌FDzLݏof{}L5'q?(7 *ЉjE[qzV"x}&3P#̯"EN&_@L\7 “d^xED ҵz6B[k&* M:-㧷66n*k[~pg՜dQ.1$گK/;+)H7,_ `Ph,[ȄM&Ck>S2fӨ5,,aXPdb Ac!!v-JgxN n,ŃW`~ Njݼ%iQN wճ廥ywX%ۥv:;\)RRf5FT [Pjã˿Jw9= z#U+IκPTiVWDYp]u.<".WDa@}g'3c}o&bҽ@'rTT ݈ G)RLQ Eѧ+B6WUIxYy*f-ִ蟿{wo#_T; 5_Hٰ}tڍSQh ;4 Dirc_/&aS[yC@Ґ+("dLR- 8WVQUc<4ryhʤ.m帼;\j5*3%לw"YzDcp)(g o Z.DW 78<1 [HqUy}{9g_8qbX '@GAM샎  _*J˔ڦu[ CbhmN?CkGNlck5N6MMt`{6R7=o/駻9Ө/Љكd=N>w&.)/c c7itQ:J(偤EhP 3D!F9m(cEglrӺ )ot+:A#Όvk4:[^~6uz`dCжiuxG[H{_F Rx/Q\^N75d^)+4/:".x;:q/N1upAju^J π<\ׂKʥ \΋d'!Ik"#s{lxDo;0 r^1j@  EQwruU~/ 7^`ճa *N֎#k5<=_:m^L2˾oHp<(:/ klҨ;彣y=IQ {۶;Sz1 *ʴB8PeS(ŕsaUqae]VEwr۶ٚfFGY6&WcXގsttvԙwjIiʂ˙2X DT'ɯB~|1ڂ,Ԉ6wэcpt%ps˺(h}Brzm5: ߙ9UOW Wfs䁹O}<2H* JB+xɮϜ_;.4Z;y)@ nwǪhDtS9s߀o==ETwhv+zU7;ʟhna݌yt&ATt1Ͱ@*g Π y<@mt,dFdU>eJ9 h4[Xe,̓bYl/?Uu߻gw;ߙ|19vФ@ J m $ktФhm&vY[+e]`@XSM֭Ӵjnm$eyw&բξu>F;K>_#W>3D|~*YقǦsqdga/^u&U4Pzgl8ʯ{)ų[}J(x o$KJ:I:St C$Ѥ Nb?sj2^ OWSݫKR|P߽=j+Smo*:;v(~I>wCoVdߤl!}HhT_`XXBH |Hx+^⍋(((T,(Na.("Op_Zވ"PR.1C Q1+8ڒυk5UF)G =}:bȴ!O`1@JM0lpQ}c c8 aU=쿼_mk'wͿme[r}vd|p9+wxk;#\໎-+Rfú. )U0^XyE_1MI|a?):^JTU {<"oI4^P=$E"3D ( uKhLsMdpŜKA0~C=W|SomgbəId%nP2HiHؠ-F k&؈U2h@B&֍LJ7M ni)tctg{v(Z"yo|ÃMzߍp3׍xyg$by3Fь%ZJL>2 7r = snxMgMlJv.! rYncs9nj-AGW /!B0Y;}6`k*tP[R $Zx1 aPOF'0VE*Iy\Ql1jWnAP%$]t. *hXEEƠhMe\bOMNݮ±[ *[/79vfJܷY%$&8_1l[8,-w3v7J;рt񬢋0c PVfzTW0lfa.gslY"yIPv'qܝxɎ# Ѩϙ-^=WQ`!acnjoM[B9KcUMTJlg"!I|Ƙ9h$AͥZ.8o?5tM韐EL0gBO4Jdն6ژ(Lq_^kktst 30ގw\ofBjPe]b}Xz_kk'̢XV&dذb,mLkéD[rnn0Bp1bC2U#lbD.)م,bYćZhV't:u*6(+ND D^LXJ8I3Ӟܔ|{Yet]}r`9QU=pjg4V±WkD-ZQɈTPg#=)љIZu^oN]i7.zŞ?qxG/?:ߣX: /ЖM >Z Fj2Pu"XOwzBPFT_ZS* ő`Rr%j&jUSyN_9qfuuDnh\|`i#G&s;;G,xv?>Ke?OP /)^z62r`_Forޭ~B,-(JQcB.Y+jn J_ r_?Wp >Wq%!9P~|1ha=\6~K\O:vn\Tp7rrFue#^[`Bb'&K ?e4MPx!((1G7*P8\G>ѬvFMd3}r*VbCJ0'I((%%$i )F]BAU_|@1N:Y^(Z&$ߒ-XXHĨ{[]mZPKp% SWo疹>~̵eug_Bc`ævog>7{k"?pgWYFm?{`yn0wt%@"mG?Gh0+!3`'n7۝88#0I2䴘xA V'O| tHnӂP&Ye"|@U3@LJMβ PkJؐpIf:h$XrJAL.$--D Tb~/嬨mサ·|w>;sIl; i4&@H IPԲ5-t,| ]٦ tLѢ* M}VLZu"ib99NQ{//ߋ|\{a,-K/?@D3P"S/NYLu=w,),y6ن(Yf$|9/:@F].MG@|$: mlv^;} #Z/HIHDIAКVɄ?ASOSZ*6L)HQ‚Nb.F#p y>ALiji5|U $=}0;-F(q,{rqC|bQtsOԷs|jU,kK{.~һ^;y03o*5.`y@v\PnZj=S*R3YO`C(ׁfX:l=~>5}ə?jM'M%y۹yTGHri=G'Mti.BRFkJHڤ&1IPIR ,"y|uWqQ;EA_PRpw*1]ՠلcz޼@@=C~ЈY F p̟_/W(eP {ku*eli, / {1UMZ<[$<9_gzB䠢 稄%y_z] ̙ҚEF:L0znZ{ow,>q:=ˢЦ.U-I=D}kek@UCo,X001WsW= !u/ڔm7.oȁ/JD bI(-e,6w"h,A<l&V X RQe_#SL"ZiHӊ¥ѲO4DU0t{ ?9^o"yD3JcrHD?Omn1RSӴgGЇ_/= 3jvOOPaw B=6o{5Ak#>($[Dd;1Q"/IJHÒ+I}%t"tyy C/Wp{{KU޵^{S;O%Cboߜ%n/63Qv\c*FLRkGtJ=mmEm[ZsCp哅-xCǟ7_:;;0'`^=zkGpNwc ~ ? s9`ߖN#wT0$2T#P"_,)y"JɬӊRJ@"HZ #'k( 񗟘3em^;4[kԬpcllV.t(HYP10+$xU7G[}'{#O8U0 |<)jhuѼ)MI$O\c&G^Q_R~PbAf&Vc/6cM%ZQ@~é $O>al94~Ғ+ͧuzuWJvw{hkskbʆ[R"E@iQdQ!8,A@7VoL:PMWWM PIDɦ,: \<- 8 85ER E] P܄@YTO +p\B:U4xpyƇNy4vC8f0e!Cd73g ;9xJP4&݂t+ ̢q2~>t΍i;ٻr7GϼXN/-gg[W'^e߽z0!ްױ9t2vg˨cɔ;ʝCu2 5K5pfg :$)Duj|>GUGdj"'>DZ1>O@„(gO +6xHr =gڌ-H=o<|22+ZV[xQf]d!˖G@V Z 1 #Ȉ!ʈb'\&gU`~Z&\3W~{}KW\U1Dj/d^MEd$pxWfRU F0Byrȹ](IRQri>t*49oAy=srp )i^)gWdxV>G_\&Y&;[bvX,fl-flkYr08 K.o\]r}DG̢ ,~ S&p)?\[̢e+vPu4lrbB&-r.#3p9|1بAkp3m?x2`GEzi%r=ڶ*Ti \}e{6ZZѹ'눧!/h| k*J雙Wocy~w[1E6Y3HT3{qڟ*lumT0U Gs{b%:\ZeL::L<R"% RȥUӐBl¤&`DЅP'B)1]aR+b,ͦb_[ێWgcyKO+BDs| +h s & PHbuX.ss%!t2p)yNl^Mi솩->8{8ޙكߞ= }C ̟w&Xg?r#q_>M'1u~ ,ٓF' JTjN? j`O2 ڒff4XFghhIv<\^0E}F$K`_`bQW `ƻ]Ң7^Ě)uPN @ڕ2fhC G{TQ%v; %> emu/h_(\8 w-A5[C>>Nl'wvΎ#& ԗbBb'i:B)Ўv>@[I?ݴj-b"j4M[tИѕLuI{6CO]{G=!G3MQZ5SUR'UY q yK Z_v.KeY(v)eMvSp&SYddL%[HH40Dѿ2wkolFm>Cv,+?L$;}[Sy [K;2\<7u굹\f$ o6-$Rd6o'ǓSd6i'JRI&ډ=iOdCv"sjn>Gdt4il1 @Ou_*!X A3CRHׇv@nwrEaLRd6JQ7D#q|#8q'D'$Q=tM¿ؿ^!Gr Z S? O}C,I} A2GTp+nܼ[t'ܪs'82RSׇQZyӣ0!OL rPd5O1 Iǰ#g(K["CMK{2gyOyR]!ԏ"^,}vjӏD+}ƭVhS8zW9p SJ:kLMوF 6)G9.͵No}Wބ>q~jϑ7I,y_]_ I;G|:|ȹ?{wUA; ND1,ۿE?wRn}ƵE\j},}Bo+둷0Մsq&7E(@eVFyPQfGWjpMMx&&bcd%T$7 IIgG%{@j0/~ .SlU4&!fAL42_;e"ƀgW[jI-B0I}=8VY~2GB0aQy E)SQ5c% 9?q;kfMGyY ӗ^7ǷܖghNJ鄽7Td-5:Ԅ(&ySU^F}U@ Nap4 _/2 ojD1P^uzHs ɒn$1Ɔf,2kRaa(]V++qnm0!{ m ŁbqhrCցS5F{zy. Y֨l6&1}&2KՌ dC{}qГ::|pdaNIfu%1,iH*PuHxl+yv:U€Xsv~\3 ,׶+vr7VNFؑj_]ڊCip26(; cJ+LPoZ_}lg>}_|gm\Ij'vI[*]H e&CJhHCDB#@`R_SŤNPQ!Qiuxs.$^{;E~2E&@ \H>cS4tQ>Bw%8bέ}͚(R`(O~zdGtvihZkLzRܽץ%;+-.=Ǟxd߳O{|-w=-zܘWK_hca:"Ғ7 >˞XQ%q 2z%*7 ~PH n4J4Aew-n#2Grw ˀ,qд Z2Ia9U\o p7 1{&ϥxѾ QlpSn88u G!b?n|ry$::x v>Y'^&ς>I=7LJ~{;ܙ# ?i:$Ժ&B@Ww^`@H [`y<_jy[N,@%ZXGh,ۛR^oQ J(|w'#Hy?c9,4g/%~| >,a!'/8Zw⯖ȸ "{d(Ď7՝!|{tZwV"[ҥȺ.E,K1-0Bd灩 4_{)/i7%9lqbio3|8'Qh)bҘLM ^ zDp@}p,xS`k}Jsv;GpeLEzM fa%RǦ>ñ$w{0Afؤa$!fî" ;DZ00P R##M*Q !ad5 8c, xX4.0a:DKD%ID+uQgsuX?@ﵕDKJuأK#Rץ(Y1a'`ֿw!ݘʼn:c5VhW͛77j7+3F^->>9>xQ J#ev=VnC9AN<1zՃ"n*PT] C $?h |A 3 ɋ%g ~R'H.[%ι{w8Pv6kľ +(fةtVO󺜕xI/S~s @Alv v~,>|һF>ߥX7!ΝΟno|Ate&E(d3l rHNp[3!o, k , U#SN9HT׼UlxG4o̫ EuE*ΩPݐ߻̻xw p.mԥ]Mg^|ulǎwN.\!nsa"fK) UeԉTj1iI6MɠliitTSYI"'naK"Gy|OW U UU7Hz (ѨAAn넒*wcp|?TwaZ;{a['|uHNObJd@Z|L º[A$jG֮!}L1IQ7v׆bB"xj,Qj-K6)Q&`(<:UG5>|4ߗ9_.[4K_xP)S(~ (~n%j"(%QVAȊm Ҭ&-SFu90KF"Sp" §g ]E\r CHn?{Θ6[:mgV)eb42B++݅#Cžw,i <+ "׾oĺ.yY|ip:Й/Bg0R)9Xw +1]bxoo#z)@bC? O9@}}@ޜK۲ &z5ow" y^P14|mTHwnˊ=q /y"ʲfMvVF|Te_1y,!Ye9;0q?MN>HPAĬV8OKeb |0?ukr1Ú6uilAzjCe?"_e:yk|PE?A;_=X%g7gddak?}zC݊Tnnޓz7Pt+J\c/{ߣw7sCl=lA1MǸuuK4'&-Os;Ks;KkvFl;#Gh^2F~2If >ANir8iՇ4W\U;s-ۙ &]]]suaDsN׽[ E-PA 1k fKjA|%2d-`e3Lњ#/'3_SW~8Pwh>j{j ?΁6QrѨp*JRlm[9FBXq{Gb hJ|ʠ"*J=okƫ;;XML8COE!q67ӵ>g|X~*8x], xj' K ЭSb.ÓJj хE3V"BMAzYjMannXٳG ~Uq;B{QJ0{<7hOCf. UM&=L3QV5jѨS(ʬVCRL]s5w([9nΚSEl ţ~@ʸOJ썂|@$tZDAI쑨N-1=U\g; c=*եu K ae4=83\NE|~ܕ[5[tCΰZ~ RϖnIϣK?14a!rN  t~#"wJ:SOcKhNYWU >f|9 l&hZPby\*my+Hf &[r:5-F߸ pGom`6D>g_AGд3:\p)q r1xgAF 5LO ,Õlnn J֧ Q<2FrgF~e‘/GW}G%㓩f纾9|8[x^Yw|s4|Pb<f Ѝ{x'v+{ _麞х'ot]n%FS'gn[!9̙CQֺC0VV?8 K1ri]D(TNEoFq4j*Jwwh5hU8|dcE8Ŕ))+0~}># bX-jCZg;S5˘z'@hڋi6U3abV(w9CIJsgTx/d\43`&wwNݫH.[{!5tDvWn**'Oo!p;6^d8ɼ?uO [yxq+v+z7ȥ() =;jK+ ` )|GHIŭhSHC.8ZKx6qq{sI;l'>rį0**g,R"@V-]AIJ*LuXѦiJ2JMtRWI JQ*}K<$ݦHΓ{~4j* -M[z-}]Ȼj4ah_M{zT*s C}* (?R?267砑ʭI@BihW %4F Z>U? \7 3#[#tH9FSaS4 R#KRh4Exh1C>/N8s3> B`J wIk#HXEҊR&ws /mͫ= D| B];ׇ1nE CQ]G,;3x)X&O10Œ1$SeqBvʳ5x Q6G2]HV^&Q"d&+Q %w9{~sk}w 3@#2ZZT_Qp{[mЩ~냩|+oJ8h 9S 66E_NmPl'5-4wdPJpp=ByŔNlnjn6HG9q6s>G.-I{n.Mrp+7|,H$\E pox(<M aO|:օԥ#؟0^GGmSmџ˨{qh@ԋ)|J+1))@M P(kLQo'Msvc z Ïl$X~iC~fܒ%-Ҧ;A0b; %;7IP{dKQ;7,nVۭ5`>BuamST57~𕓞vNen;2iQRϧvI+IqRn1,fMU] lDimC+E &4D`!0(q*#˜@ -V?7C@ge S,T @L5<}!&TXPFUQTDW.Om4nhL>oݼ5,7 X/` `nvc'Y{~|GxT""#≃7S3NP]mHU P*^P/6ɽ:7spB mf өWܨ\̖IJEI"5)ݜ5|vGϴl? C7PEnQuʆTR@K 9: | = {Sev+w{tSatV% $I=|:KQ^j#VpSARU;vH܎*m Rٲ7aKiRQهE ";5AR͚brv;Tqy ú;j]"'X ~AH+~ Hҕ_.QWM @BblnHB G$`)`c7l(Bp@1(2ATlF)hEHTQ޻N۱߽{=*Z;Ǭ5:&<&&&QݭgAኹTET]6|UV^Ry#iFÕ۷([WR;8vgƛԫ:|!sJm~q#۫f&4vI7t $j}mKl:/d9z<7&*[+_ȆHImFUj\ɖ[k͍WհĖ8[mbkEFFEӄ[.ʜ䐪0pM+E$ix;,Uت#T𧄧AԫTETjZAXT^١HJaˈ "ܼD7't3Zu0ɩn"7?y} Èdq#'¡  :roKk3ǝx7Xs;c71v.0Iz'0/d!wLOp$݅I<&bj"T9KYOtDFspFDrIb\Rr(HP<Z.S.zbc4u˥gof*J1R dFOj㿄"W<"&%7@҇1uHg wūt3, qv|K}~ш8؛^ݏRjƚ,o(rڶ#z.F(^z,[ -D"jJ[g)^&]wod(އ=Eq0_yrw+aFt?NgR_)FtV^$Zn(R湘͸Kk>K+UDSdQ"*şRiB@@~D^,G-6˻PŮl \z<.^bFS)\,@5j/˱8p =OQHYƫ6 3{grsL$1.CܹbJDCD[MH A# Q5E< q>HDhhRDCpoT7kff/i;>ds}| wow51M4'?*(T=yg))%rJKN|l5XῗP3vP7|9x<28^Aכ3td=ȖVj@=!&:X{a?b;̞c/we7 ɑ\ |6/%4x ` ۰CG|+2W"g%R) KyCyKyOTjڧq _99r:MKN+ɋjuqDcbltou7ߏNB6cݟSzݬ@\R? U[ky {A^aaQq-q1 ͝;5'{JfIi)U/5|Hz A- 1mr,CQKʨȧuͼPk: zO6Ҧ4:h dQ-hh$@kr) S@zGe3848eAs^!=07k1WWn'R3YYo2I_j&1iOhGN.j-5aS"rI~죜,wպi$kݚlux##aro(j0q/V\|W$l]PqȘkՃRݨz15L9>ܠfԅuĭGbdlq_:^S䋻& -k|b06hٔm.ue#}Ԛ5x"׺E0ae`? *%ץk-?/ K^-̒D~6 ͂ v>Em;\,"X|GnoO!^&1FLS#zьv_&2G)RM!}U^UւFtxmqCEa )J-ӑz5a)O`{|43a!=wȒ ʱ~gؖ0-dCdoݐnq+0B(Vҵ5bVgtc@EFG:6CJڜu:gk."mw]g<]ς.<>R.R(M28VI{Oik[`lY҈Qs?Fd2eHe"P)/@fxº[ISFٕgd{ n?rEIN=~NO"H#| GS6MR|q3 ^&T(A[:=U E]k V>)A8RL=K.A*Pt11 @A79gR<ۮR'S{ȍ6y.9*}F[%NX?6_+Ю|4)%V3Icm&NKiL\b4ni1Af?]lJeB?F-cI/}/!laX`c=/Pxֺ ZwdRPsf O%J˿/પ+s7 yHx$\hDZ-UR:H Z+B(eP"V8ʣB+"[kmGt# 9}Ϲ\n„?k>kז>ik#/I r:mkETW}1h:J3Ϥ4O&[j{`WKd^t?f y ^|HuT3#ZlECֆN~#~imX|B|#fw;u`aݞa f6>6cOfkэXgvgb2(pZs=/j[j3!?4n'jSI<82~V+ nuGZMtW鹇"%oGޑh]r'7qӚdg*W*:X ]*AA'?Ի ߓ9NSOY/P^fAʣ%! 5Ϋi7I&vs *V^.~GM]H9 7%&o#r ]3aG6ږ,t TUdg)ܠ[h |JIbIYμTLAn)szjs5S91nߵqxL y09s?=:ϟn&ϗŸn5S$IJ0"{_"A<|m"hw??ޑllg,YBɂ_j;62UtԜ N9fGALj a梳WE)MO90.GH9IxOi&ONpyejmjNLۀ;:,d^A[8;w(-~ց09-2L#$7'r ׂ~s$ːj>bɼ~"_i>x_k sR~!5Rrr]_1v!=vm5y6kvcVԁQ^}:e5xQb2}<䃔1|o+Z  -GU lZ.%ԞUu"=<8Wh[ / 5-Eh3>`^|;DsGe^W3'\ැ'j s/wz{\,+Cnu_wϿ=mCh~.t9Nɠ5ZF~L&Yr@~\F&'y#9:d-}au2 41^0Um'}rGsȩ3RpWV;rya^]ڪhGnoʩuG唺$SѪ?z&[HB޶sT?N[xGXHNMq`9l ^ ^,%}E9r׎%@u{jZ8\/Edɷ?t#\oRjvD#g g4{r/1)].ɕ2WR6 Fɜh0!V*\8rðkѐ/[s}N%c =ڞ /W_l'5G1j6*ieH7ɋ sqغ71NХ[wW$Krf[гkT֒iyOfge!XO2x"pzS>f~"0,h6^O̒A}جKc7s_#+ _ڿ:h_^@V~<:oNMmCNnfe@10m[$<sV8g5a`{F{GQ|47pL]|HSǘ:1ZWEL0^޵EMm`Jfz,`WK̬aُ*bcwl?ԩ"5 {%_֫?뎿wg5grԎUpĆ%! NLFJJ41 UјX [hZ|4Nc0 _ecjՍ}޳"Ϥ|};;O6o Z - vK,'/RY.;NGg]$_vbr7L6l} !YYfr[]!>eWznxP֔ۊ3t*VʤrRV.( ʴK{&='=tzLOd.z!~Z&i{C<(? 4r"N-pkP'Z^y"Ey& zVy߇o 'FDqo0 3i@5|?YEo JWۨF/6jxsYDŽ6ON:!}uhbz56:֎YӘZ٬냎`yP[#]B:/>p99  bLZDtE2'z, s<>#rG2.|=+72^@~AkgK"nD| |܈x͍`&'.!̀I` p#H,H rTwlbdfBIT|)s~C1-fzw@u;NVGǂC'^Cq-b/QMo C'!NH(RO/x-ػQ3}]mc05Iୂ8ӏ/z^p~LFJDgqlc߶qmcW'T|ѻv-DA}~2 =#աS.I?#io;~?c6EO-D3 gmOoIĽK|&_/@:'(v@Y^IrE6M hbMDHb* u)\oWR}}xwͿ~{q.]V~A~RmJ=VM%=5Րţ1{SGfW4ȋHg{ؠ1UiҾŞAxg/ϳ-U>N1=41\&.Z2)טk ][\~^^v-{cޚ!؅!}gK-aXO))5K-Z=Tu3e*0%Jɡ (n}Biך~k,MY ZwqXN7@6 {6<79D>SWYkΦ}4LH\t"yˉ K -00]Aa2 'pfzst6V J`4ؤE"m6`P̻pSEaRa="=0d.4+PZ`=tyBr\K8^}鹀ur,AKޖ+X5zL:sVJZs木:KSLMz}Gk,ya?B;=bs^i DzRjy SWv._S>7h$BGO"6MNY{d,2Od)ї1}׌4aƌd8K,ka)g3ᥰG3Lc&\jS8 QoN (Pj"H_&&ڥeN47?w.#rܞ < ]˝OwBG^ᑚ&Ԉwv{]܋ޔ\3WS)w]bRmf>AcS12E#8vO#8'X"x DȻ>4WP42 endstream endobj 121 0 obj <> endobj 122 0 obj <>/DW 1000/Type/Font>> endobj 123 0 obj <>stream HlV poW˫VgزeV`allc@`Mۂ(&xpB2-e:i51byH $dt~LvLMN=nXr HN}{ Hho* 5RWaV#}poM _7hc[!Cw}[~KK>Xº V>S-`, vЉF}WYfcp߮\Hw+l#}?/ ؟Gvb٪Dz@ 2Pf SBh=GKeAH\y (A|g~l'D% FCh#<|]n3Wך(L>ҮtaXW8 *?8SC  ^"N ū8RDi,i !s@pLcd˴\H9aN 0.$|f.TUWd 2}hx#rp( !S5hн^VQxc1/h, +W& _W{Z%=7m6(@UBO+ B_(7J1ȭ AȰrUBWZ 1ȍ$1$ H %&S, z=/wj VcY!WIZm9-TTV+EѼ\dRH$rD"`2Q*5mT1?-5 !M9d$7(!i@|1u\fOfx9|sO;Ny={_{ R?.W;A=lWI~NŹe:㶻:Ցeq Ċ,ڃ̩Z 8(31XPԍIey`)PYD'7YP x r~$J"DƧXDN *#Pt_ 7SÅƿcmO?EZȩí'wjk;s{>og$||Wm;]-P˭ȺW]Zwbhۙ5H`ek'?Q_`,Zpܐ8A0 D+&M0\:j]2]PW]_2*T}e {ͽ%T`g6LQ XY&'Ji:VrL ʼ ! K2O:&q +MPw427u:F+!&7s#h@7p -!Oք^oѷ85ku#0 _=7jMY ksƺM(}}}d~JXvE;oY5l%&V>{/1&W#<yhHVm>qގc;kip#zG@1}W`[iNB+WGN -ТݝgGzinո\LJ;칱o]ƃ{?z$ol$={v8}rkG\hDF8? >Uj]C?DIknXq?e/LnqwUXM:1Vs&b@DjJVIZwҿH2HiU(kId20_ޕ/ܯV1CohN$WՋ}.jj}#>tV{oj8Q %qPvHIHp LJDN#zk#`2GG']& TXH{ (0Uv㊽QʭG{(GJ;o^8>}X+*S$>\PBb vFh&ڻN:Jˀ0pq< RM졶&>{;94jzGv2=Oڮ GfW7ߋ*ZEUAă"q0u&;$w'Yɖ䇬mYƎ6IxTp3BvB (vچiNxth)mCiNim:XtlcI{Vl_]ݾ۾_[m嗊]7.Qtm|YL[m:ދWnhSkӴ'ZIV:`4t5mҁnZEInt1}L[[ȐT; -d -e(b]A FP0 Q7zvq.\ mn)^*wi`W$ +vQK"") Ҷ>`=}i!DT@#>kEň#e׌VrۜH:[rڦyB}۳|}7G~>'C kjץgs/ p?{P=a{[ FlJdvb9+Oʳ2 d,KYZBN$Szm u @7lx`BnV1qREEB!8VF]FzghtYI\&Tmagʮr'JGGp߿^ZV5#k-N%huJdPA\#ͱXAo7쐶_3kpr-+ } Ϫ釒}x][|2K,RҨ BG1)RʚsĿij!jxF>LQ$c!26=^ǠcA;L*VU*NHUC33ًE7 H LWsKYOheՈ556/.[?#m-~A֥[~rL!o42/޲Jܞ A41B*X R2JXsP=HX9g6ZLQG|#wޕǫU1M ˟$xVx"~o7*ǩlj&5z`@ C%gCCS{%¿aS<_\Vfy4wN&T XНW|8H\^6 OXH0@c:LДcd>6Cc+Y{}8'S?MѽkqÁJ&8?HGg^362Y$<@kP:G"K`8HL$X }d }XO#G#6kɭ\6)Vt>!_C Yn?:o>:DPؾ)+zAX7=9@w=lOW]}ה* L3+~ko3 F`en3Aa 8"& hfMfª"l N3(cM0C4<X lf X_?(-w[0"V8hB@l@A`A,AEM'9ԨEDnjhve<{5sw{s|}8hd2=4*A0QxO:QP W&j)<'j\P9nI LPbt꼕h+7/4kWTF.ɄDkC7^= Dpzyt( fwfaCc<<̜Hԩj@wpUDS,Xstsݺna2Qgܒc9e qD`kfM2{dlGv)og9G#IԪ`L.a2qx`Wu B{A{/F%&."x).1#oނ)-byV&G&hJ>}Q"$h ژ6O0=G r晚 nNnFs{(^bmWΎk] %{P6gL:7`.Qv2Mؐ#w|Dc [5n孎c dʣh@cTkaq,/t.Q,lFg~EBH".?O3|QThhȀtuգK,ef<8Ÿ=}%no&ےeY$l>q~yp֌{ِxomŧ>UP5;I eNX]OscJnzhH$X/_'g3!bHDTDp,:(NdPʰT䔥Q.ph4nȍ3_| + {GK5\O@_}>JWx{EؔpCaс}0gw[3oE\5ހ $]C7t*B$7 lt 1csbC3!i߈JF m1'imNK_5qrͩoj"ͤ0M^ . \{=٣Ze^;28>E!PFSg Mi^\U^, Tzq/!%UƣQ6꽊(@k -lSl6js?S`QI ԩ E>8'Ϝ3}2E;λ0#@,Xl9/Ț@sROi]*lZլl|-9|)ʷ%-[gN}Uu]ۣnlE畮]}dR\o|]Uo9uw8ǭVmi߽dsK_=ֹȠEMHJdow;NvpBqam_ HrKxn6;(!ط݇ΙIQ/lDrHZeQP ƂT  a2~MI0Is44$+Rp1U5k+כ~ɗsEMؤǝǐoyI$z-ZZjY$aN&(! M[{&~iƽ7Oכ'1KeNJ׫}/_˥:ݙW=+7~'~ 1 g'aGH0uOqM8 tId03d^IcZH 0?))UQ' -^\WaJu絷x%]ڙޘ9ct%nn*i(1.k$GF\ct h\J]RIΕc2?v9;ĭHxT$Ҥ'-Uh&xu0}w)8SUyϒ1lyieVgW<(Xm ,2oκa7>3[Cw"y5h`[ֱ {V( `S 1eQ1¬[|J&Gt:c S0(J@Px7\smE[mIEmkAy]|^Q|삯>Q/s<@""EAo 3ڎ GKUp/ ']_oөE99S5MDZT*SapākW p B~on0痶e+ K~S.d 0")F.򢽠Vz]>M\wg'?s؍M㒳CB P' )vٴ6 m']M+[Ѧ ULk AYܽ;g~{;[~f􊨻w;9hE-Xo(b ,%"74x,5}W@!0voJ#)=|CW|ֵVͪ*Oۗ1KcX=GNETDR[G (㩛)7Fq.Wf KݷɞIoww'^Z'ACv{)-C*ӠsiM:YLU)Mĩ@lgi% }oK9TKulNҍd}MMr GplwC=6؆^-MxQ~W;/ 3 EgbK9s4N{qwV> U_ĜbImK_X.M$H%[+Y$17  @+1t8N@s)n`W&`{"7E)7( Qrh-q%eZUb9 mV=Aomx ~ʬ2>ȵj/DkFuVz >C޶s{rZ~p_!_Ho.߁gƑ/xtl몦Žlm|v [G_C_cww^  '&'WmzfӋ/ysi^iXbpݛo! # 0bZ/;I\<(<ˊÀx <[ DhdFў\$ꃙuF siU3M"mt)ZXn/{R\ cўCZ,,{eV(,;Q01]@-L[A/g2e=&z#'lc!nz aG*nW\ԃ'+vk_ Ed"$TU1YbJyO;6_/ G"E(j¦2.ڃhum[{\++# D&$$ ltEH=")eʛP]h=VVZݦn֊'??='g#G]+ 3edCWևeǍʠaGAU)/`@}"S1tEJ^_EBG| y5Lsܪ`{+% "%H%!6)/-Ep MɄg?2͠ UONLBɎ)L5٦IPC

d*#4ҧ[ ~zefPHwEڏwg4ݷ'Oá>2= KNqowD?ѸV)i!"}zN)vnab?;BCK3ܭ B103ԍ#·1m,<= ̡O-7&d%RfD#BXˌ=F 1uBq"&ga(*f{6Nݜ%3sF^ӗPey{qs}>;N.v.eBdm<`P&VUIiQ+6&ԌmETec.4lҤec&lle*}TEw>,{y\&&82;'f3Ԑ[SH 4f$d(n 1%ߊbN}Ojz|]P_uͱsT^}7BC'V6 Np&7!=~YGϿ?fdž@Df:D(4HJHŴ@&vP}}wk`((r@QE j j Cu9FiIy<\5r`> PKS %4795lnHN18?? SONiTYq8MJx%ԅN4Eqa:5uK.Wޢ.0m.Y'})V뭐G@*=FL˶}sGBb&)a%GtK);vE`r?b9ꠖ2\Tml1R4cS,k걏i EchvM3T:m?0X(TT& c"fJJj4 0+p1IU¨p={+ + U)(u-ĵ+4Z6Ux|?håᄌ17{CĐn 6ҏX%%L*iT(98cSy9n 6bh8^Eu}aq83/?0g˖NGZqm70fNG+m*J `BHmi 6fQHJ֖vn (C)I*ͥ4&RI)ĦՂh)XZl vdǭYCHz!#7cdl2Ew jJ z,݂#9(:Az"/Fx!H\.x[.-hPU[~o;jd)¦`ݠD2@{of0pj?*񾰪vĿlwV?ƼVB&JƐӲ"KHONjFqMq[{{CC+>p1b62X,b)Z3".eI&CXP8,m'-;&6DfYz}{|toGc,> php9;1)&ih$')5 ]#5`53)q I5fX5jIFɻEkלA,)[TOcmGFj8Ȁb$v FmA/!$֠pɜI^\C;O7_|{? ly ?ֽ;7 DЁm;ʿ~nNM =R2Wbׯ~>Tr@݋P}h{}"iEG15_i2O~ ÏoLɤ^%L^#L18h#K쀣N1]]T"Q'M4 WjǑ4}Z׿h&r33d(’dY$B$Ӣ((tI ($BwW夳L4*>L2:/e|FmrMt?G}\̯k>]3*# jSխ`+ѫ!^'' = >:7A~?kȣډy'tܻzܻEsmװgY;GN%:.Z"+ $E'ɼ( IqWR|^0j6x,%ˎ2;ΰtv]2i ˰Kv [# xYf$F53-h > Al22ĠY]H;>&J$US &}/(P}>ڿ:@C_sqZHW ubDpkiD#@P8G,Z߰v5n;쫬 <;2~_lٗľsp%N}!5!Z(I+NģԵmPU-HF&HNcRGyIcR,B%q}g(PMZgdlo=9um@ۺU҂M<8{T_e|0,v`{e+;A/YWI>+Zo=J.{ܯ3KNWЂ͹Çs ݂vjrY=4@?}#>LkʚOv Y1)1D$T{ S~`[Цi8NAUVV|glgn4*x{Mj aq||Zt=w3gkN=b69PooOSmmLHJÞvWum}v9f]C^wn6j>Q,-Y Sn| ku ybWCц|ZS50M:(Gyѫ!'TY .Vmx{L"E M'6IA]ϚnSe+V=kzZŐ̵109uX;Ǭ1&L K<B!\2lY'^ wwz檖RuQ\Uk͐yJFNuC'oG/1)QLϥEOAE,3j=pϥk8qI Ј)q[؁X%(lf׶>WbfK89ƐLĠT9\njn=Z^cǺZ3,.>2e{'t?.R:@F~2$H7M?i^Z[Wĸ5?:,ļ@k#ˢE;Tt8k"i_Woӝ|thFX'nxYDWLتMdBzJLC4 ٵ6[-z!ۓ]-`x@m`v$pV^.糓MfZBLO,|m% ˵m3~])ܲJYQ-!>%9+[P 0(RxJ(蚨F vTڥ?GAXSXL>(TyB0}|~ó,&i WW :Z@or v i4]Q~"qE!r\!Ϝ?!0<P"`'QI :c౷?}WJ,Ki}y](.ZC/uRmzB_Mj,+}.unnNX݄(cN"Z4uITtFsP|Ttr#tHL}'էgD3Ջ? _ǺKK[uj3^vJJN9N6(QM&]q< ֧C v9]UčN:mُj(^3Uڰ MXZ_@D4ϲoڻ?l,`/޶+77,m9s[=s姞;Gj/>{_:]Tvy۵#PFmB`*@h^VmUҼ#q߫ݕf,Ke`Ph)'p_fqK0"\k̔Roʞq,8)322SjaO"5eOf.Mh FSj2BB+ B$*&lR%ABB:ҩ\FsccrqTd4ZM%E!I% `.XQ\L%`JJR&Ȧ>t ,duf/5[:FunչTϘq:qJ DmLGXێ_6AL3/ jFA3l)OɊ!5Yw!UCr]T8=hK m ʈ얮K  ̐ۆb^lT[V$@;'z;y\/mږcLm冯/׈gĻ[Y')x|+" 3VT*2xC0yyŞkg :Z @P*J^ғ){Jݭ^˕\sSFy?W9oNI.?.D~>ܠ,x9 +"v7v{uwk՜`$J@f 8(0xAM6}@]Y|cp0,B4p" neefCtbb@g 6۽ZYMO"jރh@]{q&'PKTgUPkI1\Rs59TơaӺ;OMzExSiՏdqD0YPޯ"C\<Ϯ׭յU4H qL`CZPQ7hqCy8 MѴbo\j\Pў t>9 irv{d9a9"}wkw:u{[wVr#otx'ftX7lcy:'uH+cs1$+ŝ=eGP24o3q+H/` NsNBiNsxcg^$oo$0,@=-ՠ΢0Qń#u.`3 e3{!:ȺԈ\ 'kv,8-sw=?ݛ,,uhmYRnĬܦ0kMYu@#+8~ 9h!i/ۗٷ2VUV-rKb q6H%p1OJM{DA).O  ɜ Jr(D:դǙFOC` '5Mwm"B4Q3}Cv|3^J)L~:%a5S$I1Ÿ߿vq^|5.wyidIIԫĠEk"]:J#jRd 5*^1C>͝WĪ*Rq9QEjC|v;Қ f|WCC\<*J( {?^ǖPկ }Sbc68gϗ;Kξ9599ߠ%DP$HH2( 6ZJ7ileUaZGG?6Nۤğ0i{ i4[>W<_ĆLԾs޹vWjցHq`Y\6#6eOIR~l$hUK0bDA2[S2pDu痗ex'y.D>^nCz*oYSHOӧ)8-##qFI#}I7Ef қaK =Zպ0PguIi 5m5,| raq&߰xem mY&hIP~/NFڔܽCvPBPa$f$d;ɶ|D^)&liP:#-H*mƥI/gU]텷N1LDf1^qqlu6^p lv:)FE+`5w`l¶l!gـuc$I' :,@eTN=Ovn)AF^ȋ; i:˞7Opwd"u8hyښڛ@#b"sdC ŋ$aĪB| Ǵ@׋ hqtbG&JZNոSelP:XnY Fkl[5c=fU&{W7o'2B͟c;w)GGiv㧕t)<<~❋Ϡ?mnmu1FUV^lۑn#(YǭO l2DA8 ^lљH%շb_;,Z9ё=JW]HK$X&jkc nt(oɵeekysvaB)VD:tHJO$VM!#a2:OķfHe{, _2'LKbz`g wo &kd╏R%}ywo||~#&܈ &% M'}{N< ,>a>86а-6gPQ KD6˃d(6χ&8MD;m|M_/|GR uwqX,A *gg\l l&AEHڹyY6" Xb5YKu _c+`TL0+ jDd KTH-3 %e{^{-|,C[BUOƏ=૩c0M' Sl3rY̺T"^Qo ՄhRz0>'kUTR/݅׌7 jUk.K#8N%STjwE2HhEJ8[ę8l-g ] kкjB*(  bU\AVzBĨ˦+r!%)PPSt`WE-HPRVDc1 [L p \ ojiuQRdj]}>Xq+K},F%ɿc!bsxg0JUYt~u=m0Vr+34Dסl%%6Ⱦ#sL1$$(*D4M%C=׮g=l$>v1.}W8AxPDw~>$?@kz &c8b;'qI1 R@lrq+464:u5+1*ҴZvT"@Gl"46EbM4?lIb;{sP'}]=; s) $0P 5 +mp{BzB#LUJI3)ے H$LW]"0Y5m  HL kWM'dwHN%|RHV/ehѴʫtɾ)Tد*n=1 xhe#XXe #kN'WȈ =w=f^UۖVhP 8z0K2Mx^hz4s]iH)<+M&M+M"!y.ztkuL hGijn'HGT.j+$pK Ny$A 7nQ -d^M{Q$2 61rYY:&Gv n?[{FX#׹k~C7<0Ro h6v|Y`2瑐bիD0KֹD%I#nC<^D[tPx7]3uYwhMgaKhH6TE/ "?%IJhN!@/V;*'+eoa{_M|9žd؟0,-w3%}HE= 3a?t)_WGbTˆp#` 2e0{L219a9s\4+g÷}Yم0|YV% ttvWZFB4*yd'tULOUe)|Q` ,䇊K"U"ѶP}GYN1GoxW00qr3 A@eG>fmȄK˄"LSQy |encb7O䚈NjK?}c߾-t\ݧGv8y%}ǃ; JG)f2i SPeQ!#QҜ%"@3psBF<&B ꒽]b{}(.d ̕/;[/J1Vz!ɲkh0p!̄u'Sq`> #CF>C'oteDDŭ|~m rcvvf$E'2++pLpAi^Mlm%M6-NSw돧Rz12v'F9ecR3.zk\+oE:tsrIɤ:u4]1ZІ3kcݭagk2$~ķ7/# YԂ) ] r{6>vEܹ?Dy։ΐ'Zot f?e'W]+jw.7@I4H0%Bj` EXΐ3HF Io+<'pprC JqЀ |>Oa r-=:e'<E@X aB`Px\܏I%`j$>yS-KG,9 |+t0Rw+ *jV(Q9ڻ2N$B˽ y*wsUf`]6 ~y?:, ̧=?W)qf7bHĽ( 1 yltڻm6NfyOO:s e̼'  sS$,ڄ r>Ԩd^% qʩj/8%ᆵIɒ5~:Zm0^m6=oXč4mEKȋ%C#WlR%KX$ɒ!H찖R{}ٹ@ eHlK1a|Lf@*1O^{ ^< =ͣVT)a)lԑ f]V*[H6+`,[n9-Ge-KgU9 l |%A- ^@M{Sz^Z:f{0k®oFwӫ[F}:J0rvRTRE;cQ"ic3K! *)4HI<';hCE*r׹qpREn[(ɥy,J%b/ȗ)| r>Z:I41O2S_Mqrlס}kIJ%J-rJqz,vMA]S1~Ly&RvH0!QGWੈ0͊G~a"X%NXnS<(8d4zv i濓>1e+n|g Wc[[9VBffLҠT$^ $ϳ<+T - ]Zٮ!P6mKPBPQb5>-S16j|!:Dj`<>@*l57yM5 uLeJŧBuKj&'ٷ:\ե+/ɥS+յ;֎ŎTk׻r~/6O=ٷ*Zc,J9f_^ #ҝb|07ʍTm:~Min6U9忒s*C]%7}-4 jm#s=81Sgƙ3Ɍ_;vj'v֓&.&uiR#n$@ bѢ&Ƕ5҂BJ[Q-jDTZsZ'̹HS>qݼ8u{}C:g {]ԯ uXb .TT^C{X\SIoWyS2]|^ئ+ǽ:EltJe~X"i]HW-b8 S!KGѡ!o4]3ǦͰ&fMi'R"+gs[C]ƻu}wp({ٍ9ƮnŬ17΄u<0}0b_TK%\*w;KWfȌf2JxMM/ 811g 4,WM%Rʤ kaO)gix{LѸgd?j+P#Cݵ5 هXoBD5z0T~S}ON=؅@5$[8%?eܹZN-dgD举 y"$399DJ sVJrNf52-XtQ&`zLrnԴL)Z2>*3UýS2CD(xObwJɧhNR>Z?$H@1 `$ k(3^GGeLF#{ s v;r6c|9駆jZ8k7g9F+0<_ZJ?m9z{~'R*v+ksϞ=őQQ9΄3Ӗo}닇m:kOiDqAp'Ts6M${y* 5 0R1jFGDIZN1&E#O`<@10*t$*lWo Q& əXe!`=< {v=HVaahyv@~6s8o&r|~fky=ЪHˋ؁/̀-@>KɪV";qq%v">tӡ(۔0Xp,fWpnC6xβNZLc1aKPiggd01,xSQДqá (\O⃈ħϕ'8Ъ1),zMմ-fSf1P0GFϏd7SR0 \h&:픜0NQ@ 4rND( gk"dE5qK/K~L透mp4Mz$ԗ`}v?5uxbb"(N|UL6R}{((ܤX9^ s?R$Ve,{g3dövi{PM6}7fxwg6, Lm].$D Kc9q ŸiT-Sb`2`W,LFCi  O;q.avgO 9hf2z{~[RvQjpM!([}U4#LP.%?΍4+ ß`}H@J.p;}uݵȂR>Pl )!_=a}N2Ӷ| nbFh<t"ϩb*lQl*>G\E}ewhA2 qoƏ/Vq"%" -A4ZIh4&J%GT NH47lA=Fo) [09of cLDrGs$/;. o<o۶yq~ԅ4Y$-dS- MG۴ح,XjIJJ@[lk;$EC=چa@a{צǎI9+͠贴l*Z?)O7znBj"ag,zXSQ#|&P 5ey9N2ΰ5H %E !` ݡL^T 4Ssli P!<$ 4*E.b1)a$S,JfX`{R!Lz:cLX7kybɘF 3(H&FEaDB"y,ΩU iIJ61Y)ʆh;ʲٵ.z|Vyi_GgsHWy.AE8ѬD_ :@={~67Ls 5l2P\g$8+!`=pCb%y*R\Sp q֮6HLjwj45 8ӤXA$>Wթ'1?4.j/ ij/j55c2BnXq5M6;.墂e:^ljhȲ:ѫ r(3@X"(M?nT WqFf &Za.BaZD0]2qaD$ "@݊!5t@ՐQJii ! : Iܔ=/jЃ<es~Rj@%R"gHiv oO/S5uCmo@)0SL:RcpK\X`Ջ;`-T %no+PiMDԎrlvMF -yHFr*+3:吀wegEOo;YDmjojyA#-HqޡBq;j;xCd|eBUTTqoj7T cYzP4!dadh,Y(5dlH04Q>a5O^ 5NCQXT'P uѩ@}%PF#x#q?G2Z `hl݄O\OW#C7i{,G\_‚L=^648amszUW*<yg44AFw[,O3[6vG?JptG`3P.Q]\>+f'qsnRKh6oopT l77^j 7픶>6\S0pN-픺^K;v*轖ةy0gLb+هxYXY%fd . q 󅼦 OI&0wLE'chSdMVjը-Z25 Wjkg ^v)v0}'l AN2h/ľCk/ޑQT $HsLA TQ/U_.&$)G}#\$ZZ;ɕK/^^|nsHifT!8YqRe#B vN۳$܌{o][?bȥ+bX*%瞈8sYht >^l0=`Yut] 7($d.U<=FyQIIȒn<$OW,2MI8WƇT7J+N't!.Y¦lwD2fY+O@+D/!!J>Bz,њ,Ւ\r{2h|@?$" @Tc_6Մj(O'O+,iRh“&EqiN;uʅMĄmw TssXLKL q1wI%wp[npyކ7rAÞyNѓm;eTdZSi/.d*T OlӢTZ'N$FB@Vi$mMC@uB7TbCL,,YGUBcAc4æE{{>?w~=+,E< KNc G4Zg$.pw58uu|?L)lľ)˪^bH+pA/"_7H0agߠnN67D FϺ WcN.vZ`wRCPQnYC(;cO׆E{"N7 [O'+ l8=t3^yy{sban7 JaKⒸ;o F͒OF<\: t):a&;a:1 {t*]-A@ouoq>y_U v@9[O_i-!K $$tZ<.|wt̉g_?tzO<ʟO鳣:n^_ļ Tnx(3 ! FtWc29M&9~i SLBMh BlCZQś y̤<߳#FZpQcĬpVtXSFTSLŚx.XC|,ģH{{u?zٹ F:tv*LV i 24Uj=-Ymv⚢ءxz3<Yx&sń#10sHTqre@SY+"!D.etvYQ[G6VP@1Jat0N¡00Ț/&`FFJomxfMݙbSy`E1a1te׭l )<G?=44‹|ivrO#5, JGn 3c5 jX U0{yC2rɤ+"A7“1߅FB t."}Bn`J}akKOjċi(L#}8w/9Q Bǂh_jEXבiEXG;%\%VBE? FcYXn6`X%魌q9zzxQ}WbhFC|q߿[ )Us #ݭ[ƛ+X?P"[+@RbQ9t𠌚2dA(/˫d|$-kپChlvhCAU;:6|>)ζ'2JDS ŕ) N6h?áoFrM\٣G$fH?\wtg(*l0z,,5>CF0k21IQ_$Y.DB# i1B"@`F-# prCacobvqJ13 ތ1h&si%' Eh[ȉkjiI:(t@y;i@E?@V;Puz4 FZD]E ;-4RF\Ay.:*;߼S#c ѡhg;tnFbO_hudv5>I{>5DQ0  ,Ki;Iˀv%ݾ{ZF(tMXaٞ$eH(i ϳO":"cep/qoBτA5.)RZ1TCf+ܰTQ갶Fuv3\;z~E=^` ܂rU}M/VsZoExn?2@b~9;ѲJQI@5& )㻮/7T߹okinFRC^`\t#NI,xV`5PT,隖f1d@&ʭ9$pi-p\iV jGӬzBtʠXo@`8\)v" f6` y *n4p:?TqTڶ5!XuʖSSB:yUm$,?j?hP޽ M^*P cL ٌD.'CeP Ȋr2R(2^Z;@`*y-&3fHmic1?M)5XXpuXfK&taW^(3k&7yZ*E*Bg>ˏ܍% AU2ʒɿU@ꄉLDey{B7,ԁZת6 aA oU$1Hr)Q/c'e?0?zyLb1&PtrXd>\09PO1>f4ˎ=M)Nų<ؼ&,K[;;br9=3šͺs.axi 0̨3is:,F#SI 9i.ض+T!$%KI$*i$m4:]AK.[:Kl4kp=Эo"(&x3 -/ `Cvc^;;d[I{νů{~Q!JFs,a2ċiHd bkec "PerN17Q鶕5;,;DtgnI Ʉ, e'Q@jK[I-_*pQ gK'y._#NEq?vup!SWd8B\B2aqp i@& .[s%BqHqSo2 .؈e;k%}fOUד+Po6L%ak+IR`ǡz~ߧ`q>6A5Fyϑixw h{XC؛?ܼmOPimULR|,qȐyW)@=5c aF[Qxae̗drQq]LkA6ttf"32mM7no Tx3lG5fp"kѕN#wQSձ#?;L)e*1ʳڒC,)RiHRJ6o/=ku-`}EA"b54&*2tګTƼmn$ ڵ~ĦH&:ѭFQoљ 4!'ne\t~*Og(W/ߵB o{c c4Xi BZb_^^0ki<%44K + L& 1}:ssY阫K_58Kd f<#꨾DOxyh.wBӹ[]_73 L?zfRAaCO8d?а7jw~+z=3r0wcˣ_cȁC~I. m $j<׬B)t9)ˇ{Pkɕ{ݲ>'{?)ص_}/U&:\2,ioo.IFLTW@F(~vAQ@9E&PE+B* 1 &%p쒁KbbYuqE B\C5" xȿ!buh?=-C]W;O=zOBF$< є'mrQI|+;H EYMrN,iqFHZ(jEǣS7ϥNαKSJoop?KY"n4>ܑM8J]TےՓ'2h-Ai-_n nKK UMX-fxt_N>b|n,9qxŃrhkjPBVtN\ݾ0찃F̢?jUyE>gek.۬(Xrb_H=!>:K U,!7.n5z̊EUQD=J8Uq@e6}CbVeQjH1$ P7t"DŽzQBǥ)UIl$_zPdyOEI2(:FQ4&i W!Fq IUD (TǪt##g"T$JB%$HD rx}awzoED;&4ݦ'5$d'&(nPBGGHx?-$< 1>k Qx!G D<\jm:{'q$Np&6vbwxdzqh^  :-$PDB tbt/XJ D+$!fUݦY6ĪQkKu9fل:M/o.+,8Ef^]J :lN~⠋̕u+w*=T L za{BYf Q2Bƕ (Eԇ+9.]FZfJ+,*(S-f3iƟsXe[FT ;E 4PQ&z1[a%1?EʟCY̪ӰC'DPh04z ![̝).'3ݘӚsL`[DhvU8%l=8>+V?Pyl'i+O5EafG2 긂yv 7cL:hjԿY v Fq##OQOC`qKF1 .d (釨۠1gT&"ZU'\c.#eHq$ Fr1X>P ܦhN zqng$mFmN@ DT:4nɠ_UHH];~vqkkkĥqYy|d!@\EbJ@57<hhh/Udw.ku%vrso]u]0ch 8c7~|c 4kZoT[HG{/Vf^%@UP-Z֖.Dp l* v40D;MuȍYJyEE'(.nn-jZ M+Ԉ"7je8^!\D2Y!l ተ~gak/L@ބ7:$#PJPT<9#d0؍M;2ͦGkܬNU?V%o~*| zzev'GXR7W6ln<^c0W~x%TSJp+VU+{1Lu֪*)r5=;OYacz\䋧/I/Ɵ!}-(z"^?q^+g>c[kܰqsfTJMwNqHZ׷pK@!́߯۷f{W{lS?߹m_#Ďc?_-iddd3GBA* ZM6ZS U[㑆 :JԡInٔք}i`YɽG>|;>ߌOtz~Wg9p }75r&aDCd"x$5؟8Nz&Y6SEUsi1/~&A b'&_Hr9_޴jŰ٠1;ip@ SNp/>CdVefi VPE byHilViE~RpVKOl2 r1:Ct3E5-r_Jƪ06$dR//%e[}́v{\`>"ZӍrK5aAXH)'j|T N#y7^: NJDa|` Ұ ̞4(B.X*YBDts 7DϮ?h \xz)#?/Wwt=>x$xbŝ1ozoێn* nXuYȥ^\X8o_=Jb rY+b] r;kp֧f"2Kn*gEL͕pT i@>v ~}7lXcЛmh29[ }W>!oPvclXs᳌EY\EzG;&;(clen;sUK+h/otɩt:^3Ӻ]@Y7P& .fݽz drTE[Y]r gٲTfg^XMhշ&M MڠY헚9fh3Llr&25ͦQ5wU5f̌U{i|^>DQ7JcS1 זT9_#-uzmCbwn޷.#b#F] t0L4d8_AGQU:/rzGE j쵺Kd9_+GJ5Po n.ݸvӗ5C)tFNiO'j'C5SnG}Jm"2}I)$mxLLD3shG SOi`dU5 9vQ?5np2ANqD)`w6NMm{=`c;xsa"%2D-;ӫ$%tJa)+QT+% DBļK7 qŊT,Ih08ܚYx%T뤲<19??oʌNV*=FR9Ul0_ux(&պֺ&ݻWዑ6 &z9pT#`E<<4X%bL$V5T K 8C{3*g$739s0ýR06b-zCpls+ɛϒnO. )](v6aI@ب ׊uR5cد@Vo5 V'ӣLe~ǵ:^mu&B7'Ù63}35H-€3@R Qfzd'=-_,!ɶ$CrdKX؊9͑(mj m\.CJܖLi0 iitt MӘ()Q] NV}޷v0oji<I|Y^3w,aEN9@Zzjc61DjgwΣdΐ D")xUJk#ApD;(Ybj>OjRS$2nw\/q2M i65YM]ƭ+Il|"Q.NKжV];.k, ~%M_䃲& B|H҄!^xSr:V^'=]'-E2{4SngRM]lrGtCrn)NdqN/B+}wE4eE 1厓bRĉ-|;_ J*5lݕ7C`il,G'Њo .$ͪrϲ97Ƴ;/Nujiup-}9` 8~s `At!K 2t^K)3Crd2p,ԑ(xM23G rsc)ƅ.gIHag&d ,9cq= c2ʌ#ܛieU*^\W{^oHƧp]:4D:(ݍ"S-DD ޛXb=ܛ_>d w)U?7Z)X}W7nQ6ߣ=/QmgPlh0pmLZbrj6I̘&BmɦCnkK\he\P&THo5/{b2(L4&hZ#7<(%T$|Q'SFUb*TUS)el47vQEe=.v6 FRQis3.UEJ@ h2R(拷طNU l 2?3=Xamڪ:6{ eǽ5Y[׮=t|Bg {zjʮ+>m4L^vmDJ @t5 HSR QKdP: #@OxВ> LT'+X&,ri y< ^&hTLu'_J><e~`3rz`5` -UG9 ˨zz>XX+дwOP[(J<6{{z p@-n~B|l|p 栋E>dQvi^ 5;}OP?D8_˟|楏 i93y4 wJ"/Rt=xn~Eճ^;#Fn#F1bĈ#F1bĈX0jp1Mq< HDRDThh@&0H F`,a`!Q%Xex{E|9z*O~I:Is&rW+mwiv!Q` QćR;WZtJ hB#d?6 >lHTg+Ttn!kȺY4ded.S.щ#=d_/# 5~ LVu|A 1 L5 fԂNHA0 90D'LF)NOc|ߥ}wȃ,CRI~)){0p߇3=otmt tԄktΫBN G|Z +ީ&Rx֡@aJCscCsa}H}0ֿAk[;bGm 6j:wνj|"Z#&+e5`Ӹ."(RSmY9VS֡&mЉm1j|$Gd{%S3Q˹swL,}%j> 3w1j=%s<ճ4jWP)-1&xj&OeIrUQjcF+k!ƂK+N6UF`LĿ"X v{U T_n2ыu!,Rt!A-DO$7џívޛALC \) (O2.sf_.o.;nPpO/QE( <]ȇcdk+p.lSbCB$(u9TvcT(b (9)[$rV^:uw Rm<K8jrP=Zy1_AK|j6}'&BlմmJq_BS=Ᏹhct~\@ܿ{<vYH,QSVu%X+QЕЅUA􋠪E<6_`te.*;]dx'r䕼a iSm4/od*jj sq8rvtωLqT\J^D"o# i.9<_%~#!G|Y$ZGVm}W9 ,+;jHPL@b(N=6A+^3 2@l^>UWW!_LDH."K`k1qZ\ D.5]F)},[o[-lkqGn>?#_USB<9,:xلlJ zvt&p.6<\̳`Kx)ε/mo.{v/|'()ƉElb2*v-cdyI#ȓdm6EjGYYz~ߒj)[6X޵\ګ"9WD"e\!?41 %>E,9R&*"a8 ~Vo@m8 |oBA S@R.O~ jrJ01h`tz!P?o+lx-ӨLnogN6Hrߌ*^|#i4FDxma xx;eyשr NlhJĄO rDۍ?_o޽zx{a]B])rfbI{<=pPf֓cLf<92#mdFȌhhy$aBg: f=!^lwCn1+0m̬|.w&^t8KC-4 0Lcnp!l6A!tL򔘓r ]D3&9ƚO%3iq27j0;|=؝еQyД=ni[Eģ[[07>krp#B3ZbYQ˰G`O+uO11WFb"}&-oح.Q:fzG's@[-/dORb[amO>6Ͼۻ|șlGm8;8i1g)L6#B"6E g 2(JZUjPҦP$!h$fv8Ъ?̛ͼy %&t2<g!%x bO(dIU ,~Wek_㞐?]!OK93B<,I$8^X/(VDc%Vwxp?Cb?'wcwwEm>@R)ZYjgMIѯ}UŵBk뚣Xچ~9#V q#H "5GYPujYk J >3+zjG*[-䵌)!E99whm}VBn9{ᰑjctոb`:[mu,=Gc˫Zn̎W?߄M} B!ZC/Hd>WђneLAfزoʆhrHa5|{FFyvϙxy_<' waF7ʾ\?9ğFH\I4|M5f6AL| 01U'l3b 07k7QsF 8hc`\<7EM.;sZXyce^#VP2(4Ȅ|$>yEWÏY_3A@>@lUak ƃ1 x Pli ,i<k맴lm+bh, o޳'}Tɰo7A`>Ejm-wX0YT1'@h_,~* xm^L W7mT&AQb]Sߡf~oʃM{ȅqW/m48G#10N ׂV"|d}5*Xpb׉{X ~0l߹a%=` |\B[0L?sP?ܐG>I9@l8z6Y@~̬wPR/|3͹9Rs.>9hS$ߖJL!_P)kU\\.u)cR7 BGh~߂CSRӟ:R*YrB07^bkWFtZ=i8BuLɺW@t#kYF/]6@P+Զڵn|#o.T3H݅ v*_xiI_{q:I0x}j>j> zڧDO d.RJuSczG3{.6Y:,ƽ>w뚑Aɂd9ruĝ;VۭwrU}Ԥa (I!Y瀲7 '5qVgo^4 sQ#얽B8b }ky )PT ͷ^xLӛ+xMslL2(N~HUCe0z Ƞ4Q{0)y,zT>e #~^-Ժ*~bZ ֙4̧ #]+_:#aeC߆y;AIvox1A v݉4{3+&EG6ʦZzE@Cj:d;P?zc9zl7Տc<jVRNm̛ r;gi7h-{>8o1V> ̤JԮRY\n&3VZ_D<:_]'񶻅k-5x]àt"4i_D>~vYmT9 Pc%Sb\zcX3Sf A!l~ߺ<l`?M@=\oR|ԘndCs eyWSإlsoҸs;h'hFNxZN]<,>\},9DiF$*ܥ3x"O9? d#Uʧx&̓D>D >RyT0@wfmЌ7V 9w3oΥ<_G jH'p< d[7}:KhbG P~ MC%ɾFq} m8oΡ*?qxd}B]'>w/Ud;=*B[0;ȩ} 9+8kl%[/ @Nwn݂ .}[cbdV>Ě}]̟8 lK=kqS"ιju0$ہ^NN^Md"BHGBvrNbE~pi-0wdW⥥p\d#/?0 F'ƌLd]/X. .aV'#^FNgf tg=. k7gM8;MOx6ŗE,uh٧fSnލqTaJ2Dzu@J7r {lpoUZYjQ K< jT蜸BD@>iQѾ\l{=l[X+kc3? *eؠa]^-[t!% jCڰ6YB-UkZKk:5{nU]rd; aG­35 hk=D4X`' 0͉8'✰:auJ MvǓj#GqW@94MGԐ2 jI02+4& hKi,v|"\DѼhi65tU*oU^U򄼡P<=xVWyblldExtq0 yWp1+#P,Wp;Q2!P>H k/-zMwH~?ÍWEʱF{dtOc^ewJ;La6Wϯ(XE\3$>@euek^{ 닦s2c{q)SHB.>)CR/WPHRTD=NrLR]gs9999s9l|.CHzHr)\5rK9GL!S'H zF0'"\ ems&)0rt-S2 o|?B#Џ6:hi[Qb#'G=lzf f#GM$WW34G|=oL6.5|U A6<@,Qq#o2xdGN:x%QNJE;<+n\N9eF7݀X._%49k >K8K("ӼϷz/uGp!?ox|ن;^w)^+ w8S2ϗR$hY/M|FS|Ib_ ;kY[[ZYt沥٦ڦl6ͦ'Ɔ_aBڥ !v}|;XRbuq"a{>"fBIJW -MP/0Ɍ ܼgm- 'c7V>jN)֣b->}'~MϷ ZE̵Qd%h^X6\ؘbtlgj(N!]P\erPH7f]q')m̉4T.,۩:^Z吃j'G[szΦl;RH_B{"DOl--XwOKtO0>stream HlTS$$/ HB !_Py()S+Ղj9hvkm; uꑮmv9=Νhjgl5nv;g;/{~wj(3[G{֓]l_p[V6`كǪثM붮^O߽НX?]t.Ns tҶ%{*Bǯ]_o~%>h* `7yoV "t.]o}uee:~@qH9^;|>r~Z+yĀPF*hgIəEXhs2L2YDgѝePM򙚒F^QX[ABUckAׂ,]?:$:Jrad$2GgQ&**Hd.';$<^?~V{ג)W]ʶc^;Ͳ58s"9e KGtX/Ou?Zr|aŋ[,IネK֎]9j1Wg.+v//us(z5B8 e\B 89R~<1f͹)}:Q;=BO}{LjZ/uf(E]L vLy\V!+ t+.v?=r.WM,KXE!tPSšCLc Դ/fs9xbN{{ 6 tp8\.,`R8y# b/9#r ke k|.bdxs(]^.fs{ᦘ eTF|8IWeTu8<:STA|C_qal <3fC؄AȬLbɔ> 2S,+tw߶:,K5gg/;M6҈O`D{%fI@%uKwٽW;:JH@TIZ۠ܬz&0> Qw7#p0l6#ڛ` `hIt%djb-6((ϻ޳}$LAFVE쯁m?fA*tUyB[+OomPck06[6k6ۄ֗m;}g }ImC䔡xJ8tD?6סFa`b2e,aFx-TxmTt!t<- v)H x:mt߹yewM5j"kk_.p=/_a\/Ysk؇ khԶP=O)$E gl&my5+/44 dJg)ex.0ӱCH5Ȁk4l8 F-q*) QX53iD:&* P*nv{EtcX<;ZlMOp^ja#bx 4CcYe&TBq -d}a͏߫H%Mmgx}KQV)I0(&){]NJc>ٰS٧&CR5>RRZk$H$PlZbmrr蟁O91C.jc)9#/vfup . j޵|y/5{:U N:BLC7UuE/k}*ɖ9X3C(d`cI!BpƢu#۪!mIh҄iL4dP6uhZ~&d2SH}}{µ[U`Uκ 2 S\0h:[EvPJOXb Y#_9ZQ!?X"6rڪx( ૒'(#Q `Y*BO$*P c<$HF] d"cc%嘤JcɥV~c4"ahďKM٤O ]5:(h\9=% ;voiZg[,uϴRWlW2,#;E۱GP0`zCRaRkEdbTF+.  f>%,p%\`9vSFɈ*"awN䢌D ȫJ!9Od2Y!O@4(0)#^΀#3Lhe+rQ&aUj* J~̿26,`2+t? @%io d+KVg@' M\?Fl1.-w9&MƏgh~mi#xSM/Tj<AX󻊸J,)vy}Qv%nvѻأt7O /Xf3j,6C, M ǃ<4ACKGIRښ-(Z%)ՅtP߂1*,iL5dRڿJz"mO%qߏݜ,M7I*s)5>_jqK^ձ(WSHEo,:{2w[ 8 K"̺V|]~/ӚIc1VxeX?L/m7w8w{'H!8C\!i &+50PzB>w`Ȗ r[';,*RN%}/b-YƘ* :o$v|"L5Tb$( S".#(ݓ g6cXj-5ߜ>3kJ-+_iKuaOoc`Vw.>mV t:R>VE5S`h:BD7JeH']S9!k`'$fpT$f, pKb֨sU8 "Isr^͢F::ϝlhp.P;6E *4+82yLO6 =km+JVoKxPqv0g^u֝Vv_8)O*gmlvJ㶖fRUj=N*!šJ@AYO-S@[ oMC3jCaW&a gj%*?\kz΁>hY2ҸߵCs7 {n4dKȗ^ B9dQ6*F5n>#}s'Ic+T2=sM0餡|0o~,2RpU͘nj%=jNoKߖ0{f 5>2L@.!{5%tJpTr|$r?ͮyd{+O8Pa!hXs*{-Ejct~sf*`ĥ$Rf)0r+:^zHȷ M:9"5aikGؔ犧g:E^C=~J;!~r}{v]S8%?ik>ϽOOgI/L쪁mݝ>w};&l>;d! ! ؠ Q ȠZG4Z:`a)c4!!k'U6uBZsjN{ﯻ 4FNtfndp-ұ e8$xO̝ZvO:βȔvu?vA] Z+T4:֮+UN@< v{<Ʋiޔl`*21av.l?ȒY,kc{+@V屳.ąl>A9v8al{a ڂ;eʂ!T(]I zYZ>vbEka 'LlM+&uOun =V@,\ɑй/ UuA7o$(#K&U'?$X$ b s{ A¦6& Dwr-6ߑ jdkpw;)_Uڮ]ZVDP޽.Wxn{f5I -s Vm{*-~,pV (B߽hQn)} ޅ:6'+Gge=kW̯]koj{MZNOiPF8qN0%T1-6ħ-_gī;nƣ5RR-_+,~ȯ6P =BSxb2.>UUqWQ(AplF{SPm=~gqBkٚR?6"h6rͥ2 j4tUrdR&xZ\)S뿵dQw͏_M&ST}_ $zO4*Щ'C`3he3 JFW+ӈnY5my'i:helnot5>C}+O:^d*i+_UC7kca,>,Id\Zf`||yRSO67!j  hF7oS* .¸NJQT64WJFgljsw3Y;nC}tS<ԯN{ύg|ގPTqA!p4?cV'g}}}%&̛:yr\9ESEaS0 1 i6*zhSun4-{ /Vj+ _e}X\9]FK].lk Ľ:!l}@ȰBY]xLfQS.N`Xhh!I t@.a5| S6óD>H$y 6[,tsy{%K+tD \+;q!{e ?O 1)Uth_tWHb%()G\B]ۦ'9 «*q:fwx׋Ş@@iF 4i"[Md* mEӪr$MGFQ=RM7TK~x|w}zSuKMQjT"x)4\g$cef/䇳X$z7p7 s)m~~h.GayLL FO&]x;} 4&Izw>SmkG|m{am쿗ږ !g(aή\Qu렃^Z&;H2FEjXB{f)+Yv*IAY@J@T-8Py_$?y}oZN.q~^^RH ϯ1t/^-䔤Qѹ6 ht0*uX\.ڕK]/7=jR2ؠGॸ1 I ]7~~)_ AL~ZOMݝ X^w=ȶT U6yiWhbOK^X2v;Zm skIiKU#3Ƙ9C^j?[RZ`'X2 xkӞOP _,.ŢB|>YMWh4t <ypXz!d|5C,om#.ejH՚r>$v!QƆ*' d6Uk\$&2TSzҰw˵";4?Gu\틝?SG{|0l{}]}vG )N#5{v`VWBZy$L!{7?9 *Nh qDY^eG3 ~\%$f!DH:L4sp40D$ )S*KYEx`2)4 R< ,`;2H$j*s Z)^a$i?$y@ݽEzv52vD1yb_= 46%w>!f֍a Y2OO1dlc wau\ ?C('G%s(n(|v}H|`4Gokꙧvg]ʁfQ}GuwHkrR~U y{) Zh@"?zO:$B{zR[3y)6n;)YX!/ -6OGc̘hH4K@^Dd̊Q+,@Yc8w`cl)'{ =c4WN0q8!3ZfgE `KpW%z` * MLIΎ*~RmDPK7L(mԲ]2Dm4g=p:|+of{c ~ĭur@3JO Eog є7nG~7ٲz&OQ)+r-~io}q&J!%}Rp:eESC1!7RۍP :[#EYlVeo9, Y|#˷,.1bE7'׆ﴰ73m鎽n{0 JԷE\*pOVov^DW^7 s_Q&t%Aqb`cR}m{6-X֛Vd x Moi׻C2Νr$UriRMkۨcgr;w~m/ /z{gl|,AKbɢsIΐB%߁Z$Gz\|G!$sq|P.rX2:?geslNwDjFtULK\f,~JrB>rA|x,=X%('K(۠ڽcWߕ+>bI|N. EUBb",p>$u2%b!S"\H JDT Jf2Q=$zHE-#9@SiUWfP ^C*N*ъ?) ~T?g)=|ŰS=5 =Eny}E$';+\Mo/Ya>I5Yb8&K$ lj$D)xd!Ċ{# Ή$@ЈՆ Fd&P{^E8wi ߓocWkmr`J-B[b)t5R'bqO#q cւ<1uw{{;eSJkk4'u(8$DSO~yaUu⫩}p|B!X"zV/_@?EjcդTT6m=;eǛִFOyfoK?P2ҍihtˇ1oNoGP |+4œSxP&vz~##6E(<ב It*EzD%4YZaL~x{c;iv _hFX]í7za~X{}>,w2 -!YzOqZ|ᄪ1r)-jEr^k4R/HYnk_|BZv^Fp.GB"Q8a4107$L8P`An JM!ӭ CL6&늋ےp?om1vu<\K7woKG4 7|7C嫏Agkݧ[wlc@p#Рn%I{^d^hEIQ 5nP"V5Hs#1-(RmK'ёD&*JvAPU75mX܈/~W`p=CcQF/{G2դ]qQCjFL""!2&azђ9n"Ȯ\s}8ͺ.*wN;TdžQC1 ;fl</y(BoY")b,ړ˗%B×9  [Slg 2>1Fe|m8Mg1ث&zӽzF]c$|X7z8YOzYOSVu4 @[򜩒ʄY!aZC4FFI |+ѪPŒ!b&X,x^P^q-p%,HL.gGHP$$1:^9ņS*2pU˶N_3,ĨZS@My1,Xг;M '?[P[xmMRa ڌ4(L p-`=mY&R엵&чxNa O++:C+S_^:6.HΫv='Q묹ę3Ljom(9ں眺#rC4b>aE;N;~ CaZii:"+_VP ` rL&(B.W0L}4t"›b6@Qkm*+0mSL*HQ ,RN k d@ H!bG%'BKrĿ63w׻7vs8vpgCӎ JZTEEm3J$McC6&B& dL[V_~gZ{|w>LI'D(ƞzs\ Vr=b%GH/"dLT٫z5G-ؤ4)Oj^o jjsjRM~UsԚVԼO*rl|~1:<;l?{Fa;a{]&d/H(8M!t"M}:HFbq ! u/ Y |dYm4HLú4;U%ޗxuTS[BΑ6pn˅T^D<+Re/7m3Z@-pim;eֱ#gHW@7dou>yJnnHrW㤺}~U+]pNj7CQāx;KmN $U{)o>$JnѽGg =IwY2D:T0ROù:j6Jkߟ8Q ^hO"Y n =ԲUECz؃h Q~JWkя4_2LY:.0t[3[c#ьy|'bu($&OfCPf/,*`22?pȧ2g YGPlqYre//XyWH›[p bYS #&kA$?X2ɇ_^}-\髬Ee!c]+]r+O}ە+knlھjqZMUE mnw|tK{e=51ٷZǞ.ڹ @RVڅOd{#H'$ab.| Ѱx<Zu1 Ȧ{3CdC$ߙO:1ݥwmb$ݑ7e۶yq~"-JJ.}ZQ|HlerndQqsC׹lKͺ]t[6@YȼA[ kf{Ūs5˼]4KLKϡ ,k̼|55/6(Ч rQze4I`A 6Y ѧr0hM}BG5(v}cH"IΔ?pΙ`fv`Ұ)vs- ;;Y'3br9^W %xz BIQn*&p"=a_:`eܽonxVJi RhS PI#HT5΀ gB6T~d޵7 /ߓ^:c̩|b/y;9޾ͲDk,΢bhsnLt`ayueۅ5]/Di#=@N2jiUamK`9HiMX,e~B%ɔxlNhDBQ0Y,&ERYL7Xe,*KcRamdxm Í.^!O0Qp2TS0aw*Z [b119MҸjuYyju"b|g`OC UjSO?eYgzv^xvqmTgdO͢7v4"r !ݚpnhN-V2HʇotR /leeR8YZpy(jdȜO;f{qZ#[^F!<(G=PEOT}X:Ox֍lw t[{gˎ,ٲ$[VHvl˒Ԏc% $ML@Kٍ+cʯQ`;ʎn-Q6h2rݱz?2ccn$;;r$>!(YA]BB w}|%`* "?WvтT4M h8!!3)& +P-$<7Vlx P -`Zt;sA%҂Ȁsgx "Mp`ZhC =,BK[9XL]h$R韋^+XJ2s A# {WF$aweZ lݒ ĨFn 7zq?Lā >NU$I(2.nw E >,D!-DHܸbqr0ؚB4jɸ*|^,A <piT׉2o/s٘H#jjmlU\Uyԭ[VYL@ep$) c-Fbvtmaߍ^".0<ߵ=4u3 z'Wf{ks"\RxIdK#_D?%7n@2km0ځbu"FD 82vOgCpmt]탾)-SzvT},M<.Z}4r.:o54F#4IU9ZkES%Ybqmq/цZk1}jo9J֯ hÿ$}&b+Ibv;y)4x ݂eܶ.6uJ]! K2tj^eB*;/{"HD>c7ԷcA<սi0&[ؙފVџ)n|ɿ3u8?z8z8 3k~ %I^ym~8=;Qdr`t~u‘с / Ve6w;j#f=ˣٱaO@F^o'}`,ϋJp4QcuFƆ[.H0B\-O)S'¦Xj&S 'ŦTm=4O>݈lсx~Dm#Go  /YS>Me={e[W8+sFk&M,޿X_M@֧Ҳns48I-)MBֵon믞o^"HQX c{= űz"iIPF4I?l" E4,QR-OnRjn6<ӻ 0lJdiцO"s o±/3 ";ړg7~7d:7@сjvۍcLj'e#=[;y/o޵U!{j^gaVNv˰rM7ԯvC-oF¦ap4=+(~An.f+N9e6v u2ؤ`|j$-; DRIh+d9HwRLT*J.ٍt1vsF VmӦLfi%Sp?]X.SnLL0 =^I| w6oh۷-Q70g!l98J_hLǙ̙Ef4~)[VM 7P]l}٠FKkSY̆ns919X"FAErq mO6MS;KOƵ Pl_vVD>B,7KH #CB-ڍ/zf͚'er=r:02b FW.slk݌WpE=pټc>jڟ %, 7[k;k 1MM 8}6tJ~?vLR6.KfWa .u,Զ֦bҢDZI[j%F IlKp\h$P@ %IJIRjqDyx šwH|?O*2*!#uSE3VEEU<;!2cc!B~>tx%g unU;U te*熟G%FV Xw_ٰt#,]^ULk,2-ζ`7:/~m`eoG(Zzzi8<ɍsIpԀ`Kp @$8:*1y2ڣaй+bkɀfVģS#MpESɝmbmPLfCxlQf7u$嶓Y@`H=L'KfhgsG!LC&An`IIpI7Xlv(n[p|KQY|7XMsh3P${M6棥-翻 Mv&j|S kL o=Eg$ՠIC$c+d>Q9ko_> M!`XA9hiw Hw.;cUjPwyY}=5\\Yݓ/ɽ|U6WOw6u8^;H8>W 06dme n(F*2ԭ*V2G 1 eZMJUhj졩$tu﹏?9jޘE,nT>ߪlPqwW 6?؞x=6K2M@o&kYZg%(4ID >,{B F.? @@qڸюeg|[SR&7 o poy4QޞIxY?Ssi?S9@vA4hYscP-VK:֮NȲό0 G}mq#70`ػpޭER: PGD1Y98=]S} 'nnlʖp&w4-d9;SYǾZ/]djn >mA^ʱB!+q="rP]ȃH\_ooƏ, 1m%j4kdE!xȊ֢ZP<3%|Ѐr3ݱd2*rQq ]ɭ*p&VYSX\]hvyU8P'cg#h؉Ų[xH:*^DRQikWy\ʯo|jL4pՓ'3Vr=9k͐`&aڽ@ct rf5QF~ՕbR.HE&<ƚ@ Q!El+*#t F]bXgjnNvYݝfzg+W׼>h Vg>]<@zcCh ErS؇it'r\szD]Ws ~\PSeDNHAG,GO8O\q[f)k)Wo0 pA*"7Zwv* +৮H|c wf 3"e,33(_Axl` 1L2_Y,% s,`Y( |{Q3\zQ`uTTfZwS `{bMpc^m2ʃZp'g"?Q/P8sP3P֤)sNՍvY;N<ՕjlM*7wMQSK۲+k"W^TVDQ @] >K9KNV5C== Ž\Toi:LP҆^Aۺa"4{cy-2:rCO:KNeΐ?ˋЛ y}#E fPgP=Tf fKrC\*t=+uuwGթbufi>6gp<4^!4JG)-z|^Ws "H`|1 XE)>#kנ懙/5׎j&PoZ-"ddfj`G__=D|b?=|@/^ӍeFn Joc "E;45J7ȀO[Y fA:SvCی{*ol1l+$ Mɬ/g)8&d^,CeZzV+i%z,F¶,?dڼ"D`JS )(iBP 3f6HIi!rnp:IgF ?VɈk\.$Rmo'3vj:UKY/5JsdM&'PCt;Q!&j0CRKigMe]o5jT~]Kd'-,VF{ق^۴KKÙSP$@܎b91!Ů~b YdP(AkaKwͨ7iX!#o;! h៌ LƠ FZdX\|&lGM0Q d i :|w~tEʋ'cCrUm2BoZ]2@Y1夛g5鸊cuy#V Woᔑ1rxn8Gg*Du6s*{ DNYa/!IuK` ɈݭiLea,N 仼`64V.]4u|ce[Fg0<[ھiEt׍/t~¤ *M5!) ƭ40Q (@#BLfJiPg'jOWb.pޜ21^,=%U=Ki)iJ⋃ b8s])ʳ]ΎOn_|AF*r6p`|sp!\q*+ߌ7ϫN7 œTO2׮zn#޸UD1{vއjB\!TpΉ3 ҟEߊ#VlE)kBn9W SѮ}q~=PGW^zr6as}>At=/PyI9бf6k9 o5+X3ϲfy0 y0~F3V"7csXbv{) Y:{v䛁~,MO߹l\~ؙxRx&Կ iުv^mg<1E]O^f~k2 H1ZnlST^қ%myXc DI^ċ JC&SV$WxKxGM[ 1Tl-#-_v\8|PBnS)6  uƊ 2a5%m[c+c~l-=<!^q}QiIWn\:kwA_[yc19>d8G_ׯcU=ALLz.[D(_%UUg0@B$$$BD<#y!^e"Fl+T6 VRFmӊ^nYZvr|?9‚놅8A "#1QIm¢؀qzuw͉ ILJL % H^3)WNX{!잶3MiqF'tr禮 GGAآe]XW}SJ"˶7L{ݓKEkue!%ۦ($CBhu5㓲/O~pq'-{ )E ~ b'y/AuN]@ݯz@ ߳=āX"ڴV  Nl h~w /m[{ԺՐf/GDr͢BW@ p?pNF#09PuP̱=Z1 oT,&$:yf9=?T2fuVrǀi ,6ot9={Df3i֬NCq0{w9sn"8*jmέh-jQZ`QZԢE-3oC$PB/?*krB\ Q hfQhhphVCOmNi 5'O.Z|KJ;S|Rx02x0-Ln5if-i$BZSXA&m4 S1 P%XXX.p1t688>|˸"CP\2MFchnD-L#$Oi,#|F0O^O\|nj"7#=\Sʜ [k1?3Gk0`ٿ|^u-9t GV%Y\A;r0Uk!VJ# ҕŎ#ߑ5!D#s>lu;ҮZ kG98|jrXSr=F2[2YWKnԞȼlg/0m>+y2#S\0nDwQrn>ىqAIq.oR3:]kx* \o'hxFmüpؓ[>Ѿ ހHI^P?:e:]x!XWFv?ܢ2.wQ'Q騣Ӑ${cF+2wUY00-fޒ+ʂժWC4W31qBM~3jJO,sp0L,x)^drQ>iԚD+zKi`C94ogksy4 f1#<sN)F3t ދ$RIT҇vd{!;qYO]1k1uE9pX(e"Ȗt%(Lz9+$KwZ7qԓi){Ոai.[om%E-7ԜqӰpT74Km>~݅2BL\Woh#-yB.h㕙57#C'JH'0{QF_&u*GzZ=҄i iɘ*&+x] i#iJ=RLW6*-I팙c>o6?G֊5$q&s6N"BKB";X٬.G2c_+M/4Zp~w-5(W>/e5#7X? :qX (KuEGOEqUGl$KR%'-^ȓZy&آm+ml>Ev;u{s̟}4opd GD/|p|n\ |ag#/^Dg?%@Gm\ox:c'B#+aC3 [8W% X#ȶ9&ތX˴)| ^n; tig8#ک7|q}sBHs?&Kvap ?:)AuY&Ft.\^!2iM_f~'_g7u\a_3-`l,`b*EUV kR|& yuel?x{c3yP-9FmElZnۥۈ3t8.-bCx!N3Z)IpxiRW.=϶`w“rx]w\pj.@mNp5gYqulC#(n}?>^?gܜ~tԬ)̌ɓ&SG\ʄ)㒓ǎ=jgؘaMgWBҥ4cjU!^4TGWB2T eh22f{2}fM>5]·Zx,p BOYHEk5ȇڢ º(O&EEǫX|>k䈅Qz뉪ϴ@nU4%\AO kj=.RBkVۭi7Ii6TʈUk* s>=᳄$Yxe4YhIj+Vi`e}(af`iJSuV*0@VINe\IIJ+Zy@us`o\hֽUJK&j&@~AޏzzB,$l̷̵a~K]T |(n,2WuSK @/Pur;y2:~ɘ'MIcd{HEO4Fw cGt6z%ՒҊB}-)Bsd}>0 yƓ%E&V(D F٬L HEÔ"*F\gjv3SJB1/F0XJ%5DVcGӊTH iUaZUv5W4lٔm‰zlTЦ m^aqE@;g0TlK,pX!Z\>5)Ť!۹%5ZRbXtMsՄy/iXYgUz_Nv컎DU lBqngc*ag雎Urwqo0Dq&^, O%j˥jvB.#2:ɸ \}7 ,ibf Jg%ɝƇ~/wҏA8"/1NJkc(Nw9Y7\ZC[@*]c?sѯ[P,ϥOE-B#qz !LMD幑]=}4_53cc.M>t3 ÀJ:E65lrFSo~,{mkCxh?~0 tEOK9dML_)ƫXOAPw97BakiȱοO`>m V8u8pvSXT_v7g`[KZ4ʹg!!!$@}0~rxxC_W pT=n4Dr]Hf4ȣ ` D:PLŶ胎FRe ,BuZDg|0C9nBjg;=s:o^gx'Sg 7m\ZA`}.F={amhb{]\Lڦzm`lcI?5Z`h'F ,L=8b4dXI*kٶ:~Ƕ,|y c1; #n쭇4ͳ)p?vn/֛!~>PHehG8Gh<7VPϴOrZׅ2fufQ` jPgsj0svT[fF纯[xjHjWlg9J}*JQӋH,֌RĊZ;*}-–U"ky >wiﰣER|-y.&k>nAW=~sX9>F36u峈!>oSY'|cvN|c ;?X[xZqs]6[Qk福tvj=}h,Zlu bWZJRGU}G.'LzsPaqzIiEyZW>(vhu8Je׀9>CKAKbiQ[M\p$!`|$ıda~O:,䫍s(QN1V_w#\C3jK{|zCNу#ze1Mbg(Vr ltHI0c6 zD/&PP=ﭱ v~ךk~PޙךZgj=X歏~hcDC SNfk IO#QKt2Uh{8B`%6 3p<̥Ԣ}w/G(Зc@%(ny2U]@^z{bD_KW.qkLZ<+-1({emCje1tk+*k)ICSq<h)R3R3kOQ^j]upzNyep.Y͢b˔"g D_KSPFv p0="7.)ixGrdf A=yW">jQ4 ꞊uU`ȄCs/z %#Nf,G6Q >|XL. 0)[nN jd-=.NYguF4$Tȉ&TkCs%bEKi 0MM8$$.d뾡Xv˨?]n+}IS$^wY9A48G~?jKq$+uzY\7>7)n<ݡh7;Q qP67-p1`ԕh@EO`}nV v} ̟P7 eDC[ @[ Gd@90P0ɥ@:EL,tNIm/?9h)NkL3}>`;w^?v-4`ê5abyYGTEO%gSn>sq摆#R 8n|(/T,q݂`_vbnL%d) s_'7an<&ZґŲRNʌ 7V#$#jS#lH$\R*يuMu!2n%[&DD!uSN Xg -*tZӼhnخܰ=#lO c=0lDz'T\aNh߾[j~ooW-%ɦ ̉퀸Aɖh{cNVNScIJY4@Lv$5^b+B"L yjyX/ר(sc[tZH휶I#Jv֭L!QQk:+ܗ]s,˝T|ɷ拈_ (7]D_${sN$fh;eH"3ee 5sXS laS0X$%w̋;6 o@)PܽD2lظK {(tDkKoS&+Nqe.a놄,WS~Tuy7.׃pR:"qÈYa{qп  e]w%Jԋ.!a:Vͳ$,~:X;kVjLmPZUUjDŏf9h\ݳ <^gx!f}<>۵-"ѽ*uu YH YXd*݈E{rؗ5FzDs&xTP(tA 0s.;/wOd=&. J  ߷de'QbTE# *Oo'ȷL+I{ԟј+Y? {s endstream endobj 125 0 obj <>stream HWmlSe~і6VlCXg7uc#l#| A.]ֵe@D0? 1hȈ`@JQ"h%z,Ly-\솎W\ĶoY 6Wydiv}Cx5艽զC䋒ӷ+rsx4O [{S@A'ˣD8[(SˣΒed̕}E${MڙPͯxO [i;x2Euӕp'*'hsMfmp\ѪtQue]/1S9gF5 CE8ʫVvNE]|jIuNE 5bڠ؀/0T}[@iZ`gThZ"otsjʞ4=cjy=[QI zhfȊz:y~Tp~P/cHwɾ:X2UjawD_}ۧF%~a9COS^;Ng^@1 ?ۍ8(f^?@qs?c(G>ɷD)ŕq염PkۥAc$z>ķӚ/f^ Gh i &#Ų^L9>`k>~q=> +F5!1KHHBݕE 8}.yn,d1hd8q]~pBtNso8{G P_rڹnyΑY]Fof}TΛ{syK3g:`^8(C);m\Df?\dˬI>y gsogAdEox/?*ޛA]ݏ?o6?s=q]?!>|7UT݊jJl.it(N7K0D?[9"s>_\a D'1 Y.Pd"K$rGY,Lϐ/w~C ä<0t4O[I^<]~w'j\4*0+iQ)M[!4Xd AUd` .=[VPVPI2ƻndy3 f0f('6i>}2ixI6k-KSz'!3,e[7H?dҏrGY,ke[׉ oۺKT1F?aR4vق]$ג"68yҘD/bPDR8G:Tc)j+lYNY@"O&=H8[}ꥵ-Mmf_sX8y-37XO2&Ŭ#كTEc;%~8}mN/P'1sJOy.?|zk73czdbu endstream endobj 126 0 obj <>stream HLV{lS?+}C;'qHb.icYCx#)%  EۚumI*VuPQVI]ITƦbb\u};3<Vt7={X-ݻ;OgzsKo| NϮ9q ZoCK/S={i.Go M㪾>xu[Ѳ8@'-[>޷&8x&;N6X,587?M+pP׻k]O ;D(:=tfx@zgD!Eg9Hz31h60CY&f˭Ӊ$oOfA p˧"̀W0w:US7 Fn~p+9c!դ[4hb&mymiTG6kXgSH&FL^1ӥ[K,aoذ#3z}{o]z>2^ޓfu  ~BQd3^ G л2_=uNSF$^i@L䋕|?<cHKu lN͹[N+7l1 |xx>q=;U#s\`9K'Gx :.]}ْEl:1ڡUg78h|Ȍ9qO̡# IM%N2i 뺴ng|G,4sE; MXt,aaysq6H$bChz`A?_=ķ}@ڝYjf[ȸg-ktD*]-K#&%R &ە歫fGYiF(Nc1l2WN9YMɊ4)/JP:Ciji!º1tF P,± ?l*!H4X XuUbgIsQG4dWV铝W/Ty]sp̎H|%_5}/n2JJo)tmns-s=[% )1%5Rj&TZxr2X,9aE" 1 np3jrt9,ȍ5)XIfb [Jk KrE,$?_йP*YCIHXH\qT,C;j!v@C)q}E, ":&@4gEr=Ś=$Zv7V6QqG Z>p[m"\(4sѳLX&me%\e{pL Svp\~O ^T]e3E,sg˕^.0 0\N=CG"Nŕ 8HNHMDYTsSuv9SNb#)r]m$#Yk6tZ_Gx'Icb  s7~11~ds!:5EcF\꡵/m :qכ om Pd{~d;ڱ}}_K;vO/%a EAșs&Hƾ Qui"pQp1 8wgː]䯂̪だ&H; ːPmyĘD"cAxc5*uz?dWgVWr}9(>Qz=ͪ|௑> L+VUsQk8Y̊׸VRjB_J>MRs_~ݳ,O.\J*xHZ(=Q]yC0'R"U~?m2ٷJLϔ)܆XJny9'UZ6#iv;eg_&ި+¾9yL[XfD=J^+]ɬ= SYאF.ϱXZ>֑˖xP}zs4a3/ a4s _۴kYj^!Ek/*N֙5F%7}Cr=Ʋ̩uEb `Ydn U?38YAhD], Jn!P%c8~{$wϾ˝6Cpl'1X7\R cI!0Mtՠ[ח QV"Ъm]7i`Ҧ.obj v*|=~O3Y>'놡DICOuYٴfaAE$O'uRt̐uLt\f(p^)w0a|C> ٫BV( ,hywuc %W E[ը9Z\]͊% -d g}i̘׉VW٨•y^|,o+;B4D:ZAe=b\<ѻi3?wfw+)ڳ-~ІՅ׏ua{?|_*Grm >^(lcvaCߥ -p6=C]H2@ۘ03L.1sDB6V,LrR-d5hR$ 3 bt~>L~BaDž%-$Iֵb&ܨX Q0<T!%+K%AZ(;!iaKwѱ4i:Zͧ6=l7ͬ,1աILA#& r2L ǢN 887 (4/ :5o?Oa wKVFb.& 5T?؜gDvM8#j@XV+t_]vmʞb]9\tO`[9eZy+{1hq!_!^j[6XFaV=4xU=#xi|kښ@ܩw^)cp5( {n@oꏂN|a08CMj EJWc7_XV#Մv=ms$JIIit6擅%TnX*,+B@^~`(bO٣K?_JrM& m9[_6 ֝fk.Axp"'nD4.!8I%)oXGX{Ć|A)R¬ƫ|1L3` r8= 5NU0ޙYvIl z2dcQA'f6s;.d{H1x 4^W/װc9SUu>X83bjW̼Wv8Y2aEn[xXF bQqҐ2 Qø?L[/^._v*YL |Ie>赉}_[`l87ǍX y#G/P嗰QUBF_)1eo-ZJˍfY:[~inS0)?8RD.JUYu8a^\&bek~+ $3nEr6j 7ߥH. YkXUZYp<+dV?V R4|d0INNܴ^ 8!ŀg'֠:ZʕsuhWsqVxUGTWG-i <"tY`/>b#wES/SN@[$<ϣO қ CU=D3z1#(DsnmـF 7?wpjw&uWĂ 2t ̂{Ə/IЕa5 1Х;f?2cIs8{5u2+m2Raݼ =U=G|Lu#K{)N4Aۤ@.oB&5c/ܨGː}SrL$ NPr\f#HTB,fgЊq:EYW2զRmՑ͑R)R 5FhDDyWXޭݢK/59k!zaE?u~<4&@wr}vOSվx׎6DY p6őq؇}ś n݄ay^堥Psbdfs(sKșSQ@aSD̦9[?x㋏n'M讈(3m||qw~fs)՛vv Ӳ36? b:WCTQ Q?44(:xv.Ιse av f]dI&$D/<1YӭeG]DATC7 WD#ew֪ ǛQ<Μp"y sfO~mn ] U'YLLgD}xpQsd!dʰ$}^b@%EA7BtO~tUX#ǯ2 J{]qzYmhC~z< :r%G'ZzvuN$-Y%$VUkҢUͺY$lfݥcr}K.+fj"Nky]Xe 4Ÿx-BD" ^]t]E|fi0 Wl!G;>c|B@tKecJm(*& LPV6i$Qik+y.R;EVRϺZ?z `s&wC'2;P/A*lBkEׄ\ruX@9u~!!0:SWC GWF]IڋG"*Q2٫'ژBKJD; ;:<ߡN%ia-$~\ǟjUqxS ;˩@:^\}r_&Fqye5T?(JCPT\D$;<<`eWlJ0.+]*C#t "J2SDL#'}&Z,Y݉1J2;]#+%khdU">UF3*a0h!9 <@Q:+U,fq4?Px Ʈ8<ªEB3mx>C,@Z!" N^D9t+#̈x,+T˙oܗo"hQZo[^끽=?t56z/;7w(eW GB{ViMpݱdoWS&DbA0lay0uУ.piL \B3  ,R {cR j uJݥ>(oq)am!†t>n`2 *,|Ԇ3ڼXe0*M7/}X )qy Kn 1D5j(b=?>\(%f+ă@A%oP6Ldn75w;6T1;aKžV!P[F7Y5[],,Rf4D%h_4Cs) ΟwyGQ4w{4A{*pT)3bYXqi@pY$K\"y+yBvo|MS0pbu\JLS_9Lܭg6gRa(0|l ˪"bd'n05ZA`±vy)A/,H#`\<9"k={2rR~]xx.rNV7[Ȥ|ƏϹޯ ~Rhtl6hDL:;OʑHD"JIܔ$!2-PaŢ:EG.TS5dԎK;sH}rO05ɣ-_cV GQ ;Z}IUfqAnyJrUq}OיdĥRpOgL(sQ G^O^P}+_{!uSw7Gr2ᣉF3p?» u'ϕl3Y[XŰ R~n6}hջ|!H _~|Y/7#^ܪ"4BVa u n 3QwP) p׺eXQ/b6B1fYSYjՖBa3SM 4"B*@O`(5rQk`7sыcwau}6l+v{H΍*WXyac;Nw:],zT lSkZ@(ҁ-vk e68ӃW1 8xM$B:hlVOEʤ@Omwvl]|>Ͽ}ٵ;8sN8Iۦ.4ek׭PhhiZ lX@Z&]"Ԩ?mhȕEihж uSvd>>yl&_Sa3vLxhԺQKwVQM|0/q ;z8 d5AnC%*liaF~%hGNicYyűhUִhZ\űud_eiQS9w1ZjZHh |MƸZZĬ *9in?Zv w+GۤXsi`Or8g|ӝ? cvt" ϫi-~KxpMLUtqQX=:`=X+uR|7l%GpvvQww2Mgl^q & #݆ZZċE1EdƔN.wxXZ8ղ%@#;hZFw=Z.wZV~&(@23B#ut$W+!M2qoKq<~d۽ \C[\Cx4(!ro!à Kh\rkJ[1 IDf44 oCƴ$4lhpMh`!H|{M`!v׮7=huy\L\4mWjrמq1q(߶S}32f9G*'.\Ƨ[㕝MXHΗzTΕh"<m:͐# Rъo[M:?f&{]r9,PjfE{c_4_ LMOOe.P|?Ϥg2,{ø^͆uǛBV!%AY#iwګ r-bkX@ a#C,&cq PKɐ7uc_G <xae]!>Hڃ@Ӿ',ۿMTK~ج=_\RFjC:Fϖp9Qlxڟ4{F KE|/<;o$kR$x /jd}W׽{9H0_AYIJ)FBG7ѲѴ~W{ę+a4,fmM\.Y\4 1ݲ'Lڱ$Uj\Y%RlcɱsR''RCop7l׃7n&ɤIoJDb0\YCKa c,Gpd E cDI XNĦ䇱q,#1.UA$4MVKTS$Lݘ 7PSu6h*%o⟔\đV=Ӣ`B:Tp/AtUl=h [v-hi7l[^)Gkg#fg0cCg[]I5 Pj1oև7S,CXQd)FLt'zh*rbCn3V6bmEjfL.}69`:/~ix^اĺ[,0 6eT/:.ջ }܀Iϱ9m:~PU)ogAsj!gRC"yG7s<=ϛUפۍa$(C=aD̑ðxh͞G"=ɚwndd1NF~~Վ##͒fS2/yJbFՕl9Fi|+v#GpgO3 ~_ܰc-PK(+lRn/:el 􋅩TϫL~~n8>//{eX_[%:VnjD񎈋DF9u|?Wkl;3x<~\?o8Gv;88 y,%[c5iRR˳~$tyz|;2R﹎Vwp\wxTS>O+ }"'rQSPEP.ؑobSy 형iI f3N(:ޚ@&ͼlϚYo9 Yf]ٜul.x%Ո UFC2JM+ֵN  MYf'ٟX-;%/+께A5DKan9ZWp'ϩ2JlzV5BަXsigd]Nw@oǔ;vmݘ̵JhROv{wn _Oy`pZZ>[gj;Zˈ;*𬲇E F,D \Uѫ #MI6sS.ԑ#M 趐c^ ~4w&T55~sm5oMLg< J~I29%A̲ةz(NoAp)MB(v(YאJ{F7_ UxɜUuL- -s X=#u~ۭaE_[8ٽn]7@p3v(Js's[ ccshA6y z9{pN5 O|ʹklkDTB:KH,QQgUA<pR"YAA} xWMR^/!A' 2;״wZZ{,1WbrܣxHϬxZB#0*DsشJ/i-F|fkjP)͍JČZ`D,| _"hGP؍|c疞?yb {-#Syɿ,K.9BqXg-V 1jrS]F?㟓+mt!7#R@4]HInˉ"]tb- Jb??atb [$F"x"A: {-ZYoDI8뤜Q@TS!xZ&CYR ~Dd< ڼILEx丬Г2#!7zV琯X{872P"hΏ# # 0p%2C F(U=&SI57&CmEޏoNJc88@ЧMOM˜-M;{o&po:koV<񎖅ŕGwQKQ& y,jY׳#g/s>y{ \?`/朿WbX dh\4 ʋi<@=z`rit'hO(<2L7.(a2/m-(d༽N 1aW*lr)aѩ'gs)]˂FڼxStcsE'_.:4۳24B Ͻ 7~VCֶjkUQKGS0mM?qE4O8RF[o!ۼ'g:;?n9is;@B}͖*ӯ&j_d2MaBK(>W'7é^N1ֹbQz,=\`#iȳ'ZE7DzyV oզKAfnΩF,.Uk Pľ=dY ^gBA/cރ#^ۋ VIET;ql -b%0ĨjlLsԪ^ZT,n@{@5ӕ"QgMhq'[KBgZR'}v6|<3eLrGO -7-]osM(틯:aۚ+ Ue8m2vC؃^O$LG#DĪM(F&noWO|W~Q/O mdxS0j`0ӧ2vN5dB] B F$A-0}࣐(oVE5# 9zS4!G!JZp&T;T1&iiChgxCgi ƜUQb_k.&Ũ )޸ =fУgcTa~jMգ`sY++G@ }8CvmxϹmnio[>(*Nyvf|x79{c?mK:G˳ ll{*b%W3W r_Wk.{Csr27733AuCn 3۲ùws?](.`.T&CI zdHhdy'+ h8 4 TVL!z(JD2%65`4gxcHF*^kxf ;Oc zx| +BhfeZ"_+C,g;҄n,mLO5z`;CIwduÛu}p"^LyvnrhBs7~o'c;r|6 sgX#n=3EPQP&RuF#E+MNF(yLdΨb.b$ UXsJ9-(.pQ~MqUWaB,:rd~Ep+ "M%&Ӊ泬o5$x[(iPY,ibVa奶aj0~Yy?=M'+&Md%+30T.E>1ޞuV5~g,]#Mo,:u#Olʮg _59wI_u#_BDDH %?w7_/oj;)ҵC-Zj3g9-1:tXw53;[s~sfddsN֨2Ǖ^,tz(Sh0QۡkےⲔ$mWĺ'nXcACѪ%w+P~% uLkW˜-샺}JGʅތEĨշyQ{ʬ˲FW)5dBյw#~&*g'vÿL<'NtOnp6X׶icǀEeFY ڷ7pNZ/c?GVV%\ ZqΆ_eDH7m##NyHlإ.w7 ٓJ͹5!ꯠPI3V zܸ`:hht h h:!t,uhYsm^?ҏ 9gJ i(L:][W c?3& @ @k}@^* :L7cշ3]+ahl=QzԣG=Q@Af@x6l[XfWn[LjOȟB$"o?hp+|hF;n{(|s+o[ްv~&Cz"a(h0K3liYarw9#c(ÒGZւkԮ ~ SSjt0~÷ےIThDzCFW/SuЂLBVx@}5 :2Dzr=XH!-TQIxivO6]L./:]70m2(vV8CqrH(eMj$B{8ν~bTSr1{kd̶Xǭ/Y[dI깔57xicH} X}޺ƘӪ14;ֻoYf29 +3TnX03 s#*at:c"Ӹ>$Pv*~G1M`xsa#m؉ݢKdYm/3{q ץ$HtϕT{zLQ3*5=uQNZHۡюMHf?7sA+' nHXȡ[oJ|}X+ۚ`96ARD0ԆW@&3?Il\% R<(oX qgqWH4pD[]moiL̔w<+KynZvnfF>ZUT3V%TWƫ=(眻 k|XлT$إZh4XI;5 ֶ#I%xR]R#VSMujpLklFGҊ{;wҙNY~;s򕼕o;y[`EW~vQ&M7Ż=qYSV\Q.(Y[-,]C,_X˭UՖm˳~m{f$=:. =ffna|N%x+ղ3*}Cb< n8[pJR5nm1N<<͏'n6 Oqyott|=-kKk,{i:O<>tWMR2y EǍ-pi:1ssYF0{д!)I6EQW ++.mbikA8z60[rZc-̮݉ΠEWSsMZWuSniНNtPUgիWmhy RU6Q8e! mmeJµ UijU( FM jB8Z hxcCjcͬ lTX[mzDj[!*pb^mzy+-UZ< 9zD̨b:L{YK1Z1&_җ\ww1)M?,=դ h(ziQ2M~ocAo#,|SC:eϾ`.ZKi\M+x=T OnJKz$@"09FD3,4ځr8=,%kqDQ.GlaJr`C۶\3|^1ltyz rd19w)->xi bG6#φ]6VPCUaRPx0܈}"v:)__wnd  <x 0Xn_B U QXL,1?GQ(e7H"f?@zF*u Ӵ҃F-}&ȸ$\ 0V#M3'儻Ƣ Qʇ0ǹbv>0S 9mo!kh'lat+NPDw3rL #{ߟ~Yn1p؇\ҁm@ !c/\,%|Ř}҆*!9|ck0f3?E gDy5Kl[3R[!kSNɩg3y(nxN)˜DEfCirDGy&e>|\J-~?=Ak5Ȣ|1)5T^9/< *p'BA(uDˏA* ?eD"3v kj;7ֱ-;ߩ:M;޽g={}[挍vF p GN &gChJ/eq8KǧF\VCෙӵ> ؙs$9pv|q5~S4)sVo]L<<}J1yA0 Nݧ/T[ayRBc=cB ۸~8 "ך}8o8*O#rBcL-D}U\*xT$ʤL>*ƜF0sZN+98ChRf{AxMY7Jg69ڏoi0>Ӈft OK]ciR_p ;LQG:KgZё.}i:,տ6<*+N+q^Jqdp=MO ̽/t78F?fN6a'h[\;@2e2_cy a_Fۀ5J$\XL7! K#N a5Xǡ>|hrhlе RAnVQnOҾ`M)UCvZ̡)b~A vKk~HE{l'ϩήM"d%X<'Wr }2u*`h7p|#ϫ%v=?Ҭ|r%gm52F4^ έ8rn|$˦s^ځ;=x#X6C>\9G.:gsOܙѝӿa.S,uK4mI}h< ך$ ֿM㖔ɣ[7ɦÇxIpކ CلgRh v4o!C2~ Al5=ks'eVгa]/{ĽػxAҎXa*0 Y iM|Ŵ@eb^KTχx]mQM/rTP'm6*a9N)Q~%SSbyTmjgNRa_,_7 JR\i5c~FVZSerҮbhvE/}d,veiDc*bd%F1Rk6$KYD1qBV _/Ryп>ʅT@ 0Q^xHC!0ZJ[5TB5ȶ,E-lzxR?KKRWR /)YZy.残/cnEyso;(׳vx"EG=qqE9wzqEJ`+u +vJI%wX.y4 ~'_] VT*m!z|wEWˣxVl:1^*i hgW?vX镬m:h\瀊Xz̪ j`MM\ D AbЫAt2X[ Z o4gJyoʳs2+Vf_xriTl-6+y˜ )j5xTX1<ޘvQ zUPP(P5 '( mrv˱xO>7#UV)u SI@(6 ׳kԾS<SjWj@l ~#iyfע)jazUkiǑL6V~,OU:0>Z-uAzXTTӢX5&bjɱƲj֨Q;8GЗUCTYwVFuEvaK5>CL/q4;'NiZUD) tʯ%I/ m2TBr-?2 61` V+$>;I֨~"<'Ul:F$C5IJiƩBL-&PEHą˽N)*)U°obJQ1gJ|94_=﯑߭'&暃̕1; q ˵;iUgE{>Z}WkZ5]~bý<;7e:N_r'6;SжfHϝuel<^<6%!m zb|(08s5$SdĔtU`?+r'$=\mb[A"9˦lP`7hI\f(7\>~(.ޘݖPdz0o$??dOq6-1'&_*Vә8|-ۂoxOxPKT1 Q4DVIAz96v6v_V }9#'B: ukOlG3[zI0m^1C?{}0 W endstream endobj 127 0 obj <>stream H\U TU9/"J"+ 1KP|`,|%jEh>Ɖpj>R2\RTr0%]fL?8k:}ُo^FE>Oy]T,ukZc8yeu&$l#p<.i;.(볍 8qYjJ]Y |O:;ss\VϼZ 7Suss f:VnMt47!z=u?mYuSsVgt±P2d|4Ry!Ah %}1LS'!o*I*I8Fa30mE[ eyz$ KunL{⋎u8˰ ZINjc$\ h``)6`+Vސie7b_"t fSyQ+>PݍT{$+G/|.A['k2BG4bldTh_k;lY Uy|d-BkKOK$Zk$^޴o )i)2?rKwi/ǏD YTӰڇΌ06`f#,2g7jzU׍o -Ƈ.+UFeT1_h1؁x,48adRSSuZhE(2<9˱P۸z hLtY+o)UIH4ʌrle\0vz`e2as]I9t24Y"l_Ny'*HQaVu{Muj\5~g5<|V/l]ꛪB' E.XR8K&#gMmQ8D2q2^KܒZy0J7IX=POv$@Of g>ýnjg̳M,ڈ<\,sCYB"g1㛉 |U}5m{hGi=Xd%SrYgXell?V|-ܑnj *J%(]MT)STZVs겺n'Ou7tvH2ҌYi#O3Slsf0Ϙe[gVi{1Uۯ-.z|dJR*_R+ % ST>_RoT19մ=,VOPe^4:V|^gj 8XiTumꦲ jg5%ic6KTuCj(|alJz}xv~U0H%؂T+tPF[UW>5+#%;qU$p`{щu,2c{|Tdn]#t ut>]p۠6nҷEsf^vih%Lqf:ܝ3FggZZTܙŅ_-d\Jۑ٤f"5f3icDE:RYQ)sp7G4K-8 GJPLG;($%Es}ɹQáG@gn |A*0ntt:]uxJV;}W Q^QWЅl咄d7:"?HCZ5e+죙O}a|% [`VrcB^GHݻhM6RAP}keYb4Ö>J7 %jm텼&Α 9Ȅ>/ϐJ & *Gi-:uWB)7ѮB;جf8{k1~6h9lSo ,^.sP +΍1o ri_*' xx6_ jWSd7%$]_RCW84ѿ?\RS;|Ԟ/Ƕ|*( k*KpA͸ r!e6ؠY41:ȇ9|QpӺ7o\9u+l&%K<ߓG( Fp8<[̓NYsk= oc0HlL,~/Y^-#߂|)2uqvp+E3X*CT$dc2)d|~Lo<~Ť;X$t*ĚkANZPb"~ u^OA Hό|vX橗H]Òuں:-Oi6T_ _v-hc8+?~GB?tEt) 7=}|!פh &_'AKB2޶; ' 6p~9X A;Skm~[r1dĮ-3b/f7q~98gxGO o<| sz6Bu@kڭ[2GrGgHTsY4:i\w*PuTOm*[iĵ&%E@uz9mhrruOZו'hh2 P ZT u쿶Vp.pwC| ĘKM#g19"<"^}fe"~r<8FcbubϦGh#CMuw3yO9/ZW]zZ< /%*%ZYcc0bޅ' DG\Q|O'yV2>-G~@M,ĨtՉ'\;2jqǻ>p ElkI-m.I+p}G=m]nBJl)_NQK(LnR٠R5 f#*U~ C Y#t*aޟt>Ø_0^ߥ*E?\}r'}zWA:&g;yG&ߪ[~&}?^xL5BdK(Noc헞I'C*!~X~: Y 0 7եQze ?Ewǖ k"}*ԿYRETƐC9mOȵ s eM 7GOѽwNH E c;"hU|yr4FO"'Q{GrHx=0{SnKEfW0tS1B}6ysq8g; .k LK>s!H+kETIhm:M$T,Z0tuH C톪hRBe-]di-s45dgyss9;{&ǝts9w;$$`ELڍ)K`Isx|36+:)z\WmU{?s?hKlC|@|sy|gM>i˻bGG?/'>qp)Y3v pe(Bi)$7m9͑8uȼޞ1qLri?rJ̣e.+g?fYpd/.Y`˻D+'畍#SV|(Y S8kqCc$dlSq |Oݸsӗ&^Xƴz{sLTۍ nd[2ȭeȍŷb'qq><`&{n;^ٹyIM7t>S-vtut{!;.2=Fk`O凎x6:1 ~I ؈wx/"F=}l<[k^OBg^퉱_ &ttwރ}8m~]|4NlZ0%QY!6]DGeT Ve+ӊ4"Gf#6Pqؔ_<0aK 3W;Fx7I1ʻ@U2<!^ p Im*-ݿ%ŪݐW3hob>ৈx!e <#,AN ⏑yp9-*F仔77H5kaafjw-S]mKa2 ^5Gw$$fˢcW:x?qR>?TP} {xϊ*I2R?Ŋ_Ɗ_Vo-^ibE=<46m ck1adgH$m<@q?wa%<=X;,Kl()Un"Q OZs= WyK^N<W+[@oaRU'b#o FI`܆E5pU|:Zl-(zqH6 A$XnVA BEJW8҇gUX,[*^xК5qk_${TPVܰ<%8rCM @'ذ lAΪ7_ϋmCݤ y`(cfc8 Q JS 0d6d u%Knk7kihxˋyb=6)KQQhs<0 qx,9U ^[z(/I/RD0pG=<8Ҽ}hU.=>HuXw-3I!"Ҵ0MYwM7@HK5bbmKSmPRN2v d+yVim횔Cfrց_;47ۉҝ2+%%IvLOO;ӞiO|&%쪂xHI*9ߜծ{x^SūzN/#hj'J>=G5Z[PcM= ENOr"v.hnP>GME $nT;T [Ay"=IE&ZDK5hLKxmw -},f'EGң#ѬP,LJDDtPm"3vv:Cu&sb^K 6$א ؉ Q qZ H宪ў7#)HZ)ZU\>>UU#N߬sNSt3ovo[s S}5qMM {jrUqڻHdJՀzZQ 17)Ĥ[S ȩ1=&BFCS#f_ѐQ##/$C4AѬȪ`>)-DΫ&%ݪbT5\纃F|s@$FdD ^+Mxi~KPRh@"zKXx*GrXqK[lLk, i8>CtOd' Np_K}37 lt윐rn9^9*a9(LBœA]aԭ1~@rkk&/$>` ?U6rߡ1B84@xk[bﲧ1v7M[ֲJ23pW8!ڲ,!,(VyB[hhNB0GKH13Q *]R4ˮ *RTawg0~;k(:fSٳذkREA+f,^3(mqә 5TH ˬьQʥP\քF;k[Qq6MCm2EE"~OÑA:' y4)#Ga0> g`8 8CAphvh}Pis4P9:80rjJaQKIB2m"2b޵v7 TxC lH<Xƃ$<;{$GFq Ƙ͖92K6G^2k+Ga[7 u{ Gv3qy<ʽpb~tW|Wg;MuS_POS5M}MS_+:ѝ pAΓњDiGSk=UDJ(bJÚU2._WYOyjk>U< AF&KAIg@SBEZhz OkJ]קFP<EHi-%RH % OX[Dاb̢/A]2E.CY-}bl) ؇K2KL:*5#f谄j۴蒿ItFJa\'˹F'UPhS |qv/H}>*az:y 6c!$]'|ngk>24 [oу)B $~e8ٌ 2UsEYTdU["?'дԚjM-:,>sd-[wx^?J8 :'opV{VrsTfT-cU`T7wy?;O`g~VNtɷ=Ĕ3m,g'fwbKHnV4G"._Qe$"ʼnְز71|\ c>;nۅ ys%4nr]lR: y1u%]ʕeHs͡{O.j(d"-ea-qW\6{{0vz\AKp/p86I5xsDPD+4|$W٧ך;ίr4m{^n#U;AQDjc }:ʂs)h>yO%OeuK}Tjli"F,Z8c|4cٟ6Y)/јVյzRzo]uptw78&Hu>` B]~mŋ]t<" <`qnGp=㵝/:ں7VO'Y-**y޿Lk_?~!eІR1BZG +&+|݇VҮvz?lYkI~`LmB 4JA$-40% m(6@I)%eiI:mɋd3 i;a:5E] qJs| Jdw@MWج5>'nber79g;3"of, W3^Ȓuu om>o]Eb̵6E)^|9N:E;Oj7ҽ޽Bܩk}O¸ [ܨ ˭3&&Ĵ-Mt`Ԁ.`8'*z¹4R<,85?oAr!5KWA yFJ?oUVȰR-y-bE &"DaʜqCL(1ߎ8Q643kwޔL$z4Sf*e%Ap4 s",Jvͤb(/TV rKd>֋ 3]H!;0hI#%鹩.srtߑN.y?ЙlJMw'RO_ғ"rbHX;wNhY%V.n%/UԈG 9eň TU0xQHEXYR,V#|TQqP v!}+fuIviv<IQ(y zjY"dy+?!q7~Lϝ8k?T; G B+k/۳BmT7[G\5n0w{{G|?׏/ܳ8K\<{oҽ kn%xCzDAq[cG*_&u7D0c38}im5Pt=4F:ev),SBg$Z%b1Z5MmzR m.^@D AFFKیC%@U֎5,^xZ d_zМ,lg/݅_}Bk1#=u;O_D<]hY9t "^R[?Cr+Kpݮj, 4J8'.쀵V/T<*aA'+ Lڌ+wы I/͚<|UU Ѷ&%9cOZÖK%|7!+Bޑ%*4u+jIQ)g 0F$Iex Y-Uѥ3Y~Bqc WmՆlrXϐ!1ų~ٞb$`lQ-jE Kws3KzGX 6 %Ue*i8>soj^l\7#-\aEWyv;Zc.jZܮ_ ǝ~hUmtK~` ~ ޔpx4ш@cBs$ˣj4QF\?z 5;ZuҮ%8K|L<d. h4Δ!KIRVܵPK⡎,KHy=bAԘr掆~m{Rw69+\*lgsP7>|lHG&aߦk|េb1K͊L\jr2~_!#Hü}]aHr"U݋9FLNϱ'b8#*a\bVI$/sȃy7ҲtS)"b06QTt@c 8K*);欨f0V=gEu6nj6ϰ>ɖ,'%ٖ,Nl˒!!!& % Q 8!+$Wr&HKY 3[ˠhvr]9_̾O6n7=< GLK)3m:Ɛq7tcM={'Xk(M23̵p_Vk%9uWCDPշ/e[yvboФȌRӟlI4-sˏ==}a/ t/zRii>JOSI+#+Ca2KM -bi0aGa 5Sl7c6"&.!NODRt5j !3*=TƩyR+a@(X\xxB8vD"lgt@MHh^uXDڷ앧K]z PnRY7\7^m_v{q{.ws+]q'F!L~W&*nD=. F2`K9\cz̰= 'DPؚ 2~op6 j)>_½$erv[.'eBBmm:':BcI/ N[0}ќ6Ȣ}{%mXۖ)Y=6@o:aBp :2_LZF$NJ} _: &P<%K eu2oevՎ] !hwdx(JxUסWNs~om^^|'`sUEݬ]zuK`&X 3B y-O]:Q~i`mGm8)8T)Yŀ'R[||dQ_l(x ƱNc\ e0vuk7 Jc _D AlP6Z.alP3*%7k"$2lF= T')yFPYW 4ڽr((ݍ3:255n|̎Pl:MӅz@-,h d2\W&7N_8b)c,@lVȬEUxwG~V^jVU-tW:Ċ*Q}ͼWrޕ|~ 2imTX@fJTZTUQЩx!̑,l1 vd#QoHވZTO[=O)h0ao"7AӔf(A3̎{rfrCHαv6N߶ TWmߏ_euߒ2iѱ&9]<`3i0?\YU=wN۞4r<֨ auw0' wgZCUfOOᵬV0yvH@<'[IXꅩnEG0(&e.[S LJ|uf0 g+|E8O4^]5* X??CۭV,I7GіlVުMH$X1lE9߯@xCC`-4E㤬^܌ `F ۉAmp!#T]! (Z2 Gw˥څgwҵ?8ZF~P'(\d̮=CsرvwC#`)D u>2 =0 , : KK2Rn9  ac7ngDY,|kpK)@mN>oBf\h>Z3dI'ᬂ)I>5'aBіFu=Vzxɲpy8&3\\&2ꬦ ËtT)>y6ij"Jq,-"A5 9 U]űHɱkP_۾}]'_!SjTUk9iلZHnB߿yMwf C2LB<*̨`hܟJ:Rm^o}ֵ)4Uy}wvwss'·?b%&tL(P|JX5-jY(`Ab-вmt6m*c41i͞lCY=>< w{>Y$O[LN9p^6zc#o"#Ib@e>Ie [fĘ egWbOx}.e11`- ό0xNGo a0ӕ>>=|>RLC;B(zzQ'Wy4<7u^5zr/ЁxJҘ҂nid>$r@.%)]5h `'h}-McK#iq\6aڣ;64U+x}MtIޮ^Jsܫ@U${Mpq-cr Z-f d4fWp#~y;wLpy9 {%+X"1ۋ;Ƴ% [Ea|"2AI 08Sr!rΐ; "O@ &#C8~rC+CG h%pQ'#kL yaXT%Wu5 ky\ƽ#vEiz멨X֠"4=s~mwuvfzwe[(qZyh;yF>N0Gh{&BPr8ԽʾĻĻanME.,"Kqn"VĞ_ՎߴPoŘU@UM10.guSJz}η` !?=:葭KpaW[zvsFw(! o Yը^rkI sh-sг 8(m:E8TDKDAhDQUaaI!^aE*K!~rKJX 4h0=}`. :G:+X@`yO%n:=`_Gת:єPiUu~ Sϡ.tF`WI|FE }T"+ˁ6 qv R!0?^$1.&X7P5@h=$2CD.v $bYnD,J"T6ItɊۅ1b[P+n-8Z`2xC\rMp\&?wh"|5;tL,F!к{AP|qI M}D=N}?`qjCmRᏊ1ުQb!zbB|G[/G# yO {Cbb$ӝIw}o&HM"ͼ_:w˅:ۢ>?xk?z{ y1WKS[=Ri-,r߿zQnΓؿ&Y9l)[v%ZxڱN}q){!9wKYTpKDے,fy&IlkAPKLxǕ$gP&#f>LTF%(q;頲\%/G)bƒ7e,G^ X(f(؜_ ondLQ+άMeAi&Jտ 6Y}R3X"HIJ(bL|DUZ/OV ϻWW/7Jvov}itr[Z>4~og8۪ӚFCNh8 'TH1Br4r&B?$Fkp#UP$'iuV5srQ8X̪~D9_=-Fgt+vauf%P΁Hu#eD?ZrΑl͢(͛'wݑBFNӳ5McC2h7(܃ qg_)3&u2m4EMMS3m3YEDߝ>rB!"f7*B֌e8&Cw6qqy|~ľBlbo2jF:hLS M"M (UB몕M1!?I(\{9ߣ(_57bjAV:}9HUPYE)J%:Ԗ \RW KTɘG9 KBRo.&+Otu7۳yjNke!c5gWlvS&~8ݻMA- ѣ r]|EDZkŲRe7 fxa3Ӝ$ݐ] | F#t9I^rހ7(`hIuu=]su?4."W djr THDU\%ҽi*)!8HJ~X؀^$Ozp gX&`z2II(/&'q?/"tČB$7  si~U(~/_'UB|2 UH0ySݯ2?xj[!(-ݖp Yq x.A]}c;[f1žfۗ/cof>qk+8|u!>K \@i. +C\Dž';W!:n0D 9ϣx<ӰvsUbwG WBgF|`T?]fML9 G9bqcS!0z%e$QH ׈i`Z hX%7SFy,ji ®ŮA}+'q,ϭRq}|d-sϞP}[ʺi[\[k{E9w췿@J;!AYo>>fp<8 nכL/3Ea(MXKs暳HE  ^.=H x_   M7*" ea8>PȐbEsZKg]Ox:~ !wNe7kI83$ ΠE1RgIk 1|Wau,8c{ [d&y86p7fa/V.$&M3N&ne nxʄ00!L !F֨:V8p@i. IEZ2"dď2ovԆ.?nYo[ήyK^Z̹S]x'N|lѾox~}>z/OCE`@xGwM:w X S髕/>yp^wga<$W ğOԟ:: .,*e/+GR; =fp(hn~Owqz~Uw]ձ.Șy?ħ֎|O_4]=r\.[MM~O^pIpO:71VHo܍9N4glj9B~}'ς"IMIq3ɚbn`.f HP.D-?]Vh|6n*1=$R3B\îKA=&7Ud}OU^0P>?6{>'sϿtd]H\&Ռ}8(KwTb! 볼"+XŵG zjVʕ~U]슖URKx6qqy>/Ύ{Iwg%I{R%M;Ш+0ilR :T)ష U!&NUj~w6n?,}~qA4v(Dd|*+2е$4$N"ɠb:˰l3:q-mC2J,y96/HaG0# 9z{X~bw>M[-I/*BNin>/.a6U`2[=̷׌C2?a>a>a롡7XaiR劸``EIi|cMxޑoN%Ɛo|ŠlfYfޯͱZu(?rp;.hB3W/m2FF^;sWܳ:;o y'.@wi%=]rEYXE= E"*nH҃PRǺ.l9iF_+4A9 pTp*`UT+Gr'@wp3^.+~z[Sqb̨ew}pp;h>UW-҇vV[ur;w(q6v>wZ'C84v'VB]("H,#==nFEfy \Qe)䃤˕EXA7rzH,]MTރGÅv%t_1DŽM#s#ۅ2n9dǔ$TUY ro/`5-ȉ`-JST}Lp^*Au!@46] аҬ@e@=zgw'ζg3 ƧUK0dU%Y6}":kden[Dlؾ\ =U;P2aqR( W `G1ԁچ sqy3?ߕ???ӗնK4Fw'ѯ'тh|Krch ӈkE)$]''ܐ~٧&²3=)hS.sp"8=6l.q}|@F[U(>vvfJJl1 #SR6ZTmlGE-k9TT>Z> alq6B|0bs 'eùx'J/b<)˅!h. `ksI5 mC'^y+FҼm |Mߤ] ,60etܐ5捬И? Ct(GPkLsԐ _gHځǫwzDx`~/+pE]mǍ2WϪLvokWQkO#c=Ӭu 5BӭqK(؀"aRԛv!u>N/PoS$+c)58,V@ 7ZY-pxbM,  jVw@JY Z;vp!D"៴M",DG! {vZ^l =amvqatxA>Oo z-j01b\zJ) CsM~xo^x4YT2 ^݂ 5)%n]Ql۴U_z_L!>A,[&;r^[SASESU?l,Ns}snG?.=kVn':N*S` ufzI$QWs'k`jAzi=^Vy+\yaa)9+tzQHuIݧVZgu^6UV<(A/" @{+4:~+ btL26)";z#y--|O5W_}xxiud#Y%[˒51"B#P3\cN<@aqޚW5VB:T7.UOAP&Jl  O(EiTHʿI %oo- >3a\eYg s2 .,cǁ.{ }>j0f|DcKCq k"X$U*Kv)b妒@!,1|%+A起SrNp#-h{"$R#aa,QXmMtUj_|4(rZje&+'SB5-+ɨ??:/J鰋FTuuUZ 7'Ń{݅#`pCr~g"Mktd$>pV i+|kcQʊB==]i-]O7gғisn'3NƂ.VcuvXj,ΊXѭ%.B݇SeYaòl,M[zMdgh1R0 @H$cI y `"0ުQM98.Pe}f(9j'-I 8uu hqg0XQoc`bC?"m=U8>x5y< BFԗZ1pδw8qG]$9/܄7GCh S7"#̈eXs=gJ)^t&L 1kdH ɖ %9:.Zq1P$Cy:}JɅ3Чa/xX1l 4b0喡M-Ƽ bycI=q|Iν]\[_ؽ ޵c?zf5_tНLf̕+v]{7l.H 1?nmpH>сiCsnj"ڹ/C,?`3f>\$G̓ϫ(Q~JyGl%YgMT?S!^M:W ewm|FT,cs'ĸiJc"% _DglP,,Qkf& ݴFx37w4mw*{w1{%kx u v+mv+KVح AKuc8wg+|l}$$(T G:(mh6>mVS[ Fh:U ?44RFiÞ͒y~~E6ՠ]%>ݥKcc [?f<f)Һyh+ψJʡtSm{'|\ZDq5Q~o_iv5  )T6ӁQqB =}^teCOq99бTROTs[[F4i(_~c.&.Hil\Y&C!TXK`{ +l2(.;7R^ƍ[F!q\ B[FL ,  K>a.wYK,TEM^\X´3n$H!—zX9Ci1 .-8V6`S#t3&Q̨1E"%65\G?]xazJs%`H2GB 6G3xe-A+J !_e"F XXf/_/f0GK'o;.2j_x:*M9 ƳmNlp2Y^X55x6l7gWUw\ذf XQ c"u=.}j:Hr}yLN:Lgi*Q9At#"ɾ9WsUFt:yڙnb:p+pq -eU=h >dՠ58ɵK`T twAQ*a(b2ʤQD_d=f{Xe[>GhʸBk!#7[Q84cc{x(R&Xi]S΂nwO@iü~`16@au,0 JA?De< 98Y1L\p*b[0)YZv]?190֕KX [`R7@с]GfNW]RZD۫t .ywTѩ8Ӧ;2Cxq K:'DB !AG49Ťi> o7;ͳ4- :08 EYd шGp2zͦҦ[Fbcdo#/Xz'0t 楏%:n M>Ͳ 'P}f;:zt?ϐ쪭,k+%WM=v-6;F @j@a@g S{8gif]^nq'¯[s'HZ&Y y1_1wI.^#-FԌ5n˗EyhŭFM(WNɄ$"W9d UC(dMNM.Ӕ}<5$DQɄkLDL CxЈ$ЌVTVN_A+tCec88~Ͻ:>|~l}}s6&l"TdP:+V,ARZIퟖfm Tڕ7 Z@Q {(;=&^mSgE$)ԷTU(dcT$iA|qxc PElP0\FkX ^%@Gl/-E[$s |_awG9jPQ))g{jagRnT6 g2!`ؕ F}4.gj>JJj]VRmЛ7&9O>|aWYȶh IQ]3A9=LddtZFG8c̋`,݂݂p`uԚU*EW$̕-KlD[yѬ(x@OLE˳|Sd2exmu:$sMp#Ź%߼#<ᵹͤYΊ<*VQF0137跘7L-л ZEl^<(Tr2.Y/0ad029M]ϤӒVH4Bz)hAyCPH!Tk *OS`) B*XA OJyL65,iYnSܦM$g9ٖW`*Ƽ`0FF͜e5]؄+nv;\2'E33N3Nx;%Nr}ԙ(3)ܓ\9o+iP`ٌZ)2'Fl8^nk+]BںbC G? ~D C)u7g6LKbVu°NHs]5/4c:9l9%Yi^#PX׉4|Kea IR+Yl5sjdr7gh~epkjZy% &,Ci܊ ȹ[_\0M7LԮкkbsTH P(BQM n]TJ#W_MaNC[dpo?1&܎p2sE{>lF :E, w8_Jţ܋ zS|Y9CaqEG58!DE)!;H+p2ZxBlj`ʑ87ѓ;%˜a jȢBԖCzT28C;M(J{%jKXƭY)dɣyh 7Gx<PS$A]^h"IsvYOjL [=C8I{}c&6,7X!Y,DXÉ gd0  ;q/*|ag`3љw…2Tȩ0S֦GxqiRv+v2Lrg'j97O8{|ok.:M}XNa5 Rh Ӛb))L/N=?h4zGȅ>Y);xpsqFFc]C gp{kOmNt(si3O=$G;?{塚$ c}]bO8룝AQ&:* :H#>-Ȉ:Disx,%qGs`84(A>~5Y.`,N*|^K5}FE8˭FL)׉c&QgoH qFS:ч#xFu繱Ovy˯쬤vwf+SVW[:$E?@~ ^/;| _ɷ~|1Lᡳ2dWOdЪ^M]w?܇}ﵹ\!v8!# M63* Cd6NhtӺG[iR'EL+jJεCj|ϹϿs|'fɰMMShb- 46xn<S|)x md\ 0nN<4K=0xDaU&Z_̙|L^ %D2'I1B$zbRĈe Bf&;2%sI8<O"?6ɑ$F_q _:fl|`0є-NP*vq`e_qE xMqjL}Wզ+)E-T2|Fy{vrq|qBa܉4Y&Kd%كsr6Q^K=x9L3l0v=y6G?-RTl-It!VbFzW%\|̒t:Y]Lw2w 'O\ !ᗝ߄"% 2#XQz`lPFB~noOh_leGC'bC1hL\}CV~ψy95Pa{ABJ8| ͌Y5Y$X)a 2 L5c͌31wd\a1Lr|iEL #&ALn lS䈢3)!d!7!xoᏬrY3gTYg3q'y j>Yp=Vm _,!y gmugr@!p+!<+ LC#h 2*qǠơkzk;{? $@8 9/;<(>sj6ҭ_OޕޕT\z0nYr)ey*CRfnΡYf[O"XtY\^Z}%ɐxx7f45C͂;W5W>f ^O^f(fqoD#ĞDntnw=犯WiA,ExL>̨a&PT،DvN,t-Z b!AAa* O4[D6b[}ˈFu8^G7o3TdHst%EQrTn+[fS9Ľtjj j&@+Lm@ꙚRlBTCj9T>-&6WW+ ekLhYSGwG h_˅彵;;ټ{]i*^)hʐú́Opg+y4nեj+|s8k2~hnq a *YqG!3:RZB0-ko[=RT}f&[V:ӊVX*L.4^\ۤowNu5ٱ`/y|8^ٹ~˵>מHX=jY{OP:G%aw]!NjI#KRԄG_l A%pLJIV5H鏟υ l\\{y w9Xw]̤Fs]Ll}4ІDjC"fiTVo[( &tcsNƐR+eȘ+aE>#0-ƨ[\4s&Ɛ,1ƟFpflc2CĿbc,ys9olaz0ys\F?12tdf _ޞflޥ[.W^+ W2g)mʳW4 j*2;t%Er p|gQ mŀ/ `Mr=?zW! ?};3&g0Plzx~ l(ZʓK@M9j[]g޻72福9_:.3N~ރS Š.zw`G@bO FO.nуCX -7}KxAk$[1qb0ܵ!ߵn}o*,-oCU=Uj'j;랬հlt}Gg޾Cφ1ƅ ~u ೕKa嶖APr]ZB#ˆ"S8W6NgD(EDS`S3晭9VOe+lu@-nMISˆkfebڷ ~1S#);do~G)3 r_<E QLq]Q34cԍ_EJeΞ;™!V>KNb$Af͖  =Q#-#J>2VNP[GzQ=!&h곽gQYPzt\Jr\IJjTIxEs,&ёQ5%rJNNo[Kw{W;˩Ny*ĥEEVo5*D4%$&cB^65MDT#GTFj%)ZbHHɨцt]|܋.qU.F1Fx01~x.=j|@E^Xo#`~Ezj]ϿrbcBvC~͌ endstream endobj 128 0 obj <> endobj 1 0 obj <> endobj 2 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 3 0 obj <>stream HWrF+zIM0NRy81兝JADY݀df,ban -Clǹ{;6fvYΞ%gY<,Gi}' , TD^Ù2.DJ?2(DE LR<_W6Y^zK(AxVOaP8D(p'&\ѫ b+8aa%ᗐa3e<bxD|} OsD呫/ẩt-kVV7뫖)A6fv,nrSXӱ~+ʹ4{;VjЂiB*66ɓ,Ȳ4Fh"DYd~4feA%9w4,36#S?ҠH8L+sM;zb)iy6튳"~xO2L~Z=䐦ޤ8'k׉iw2N{k;2f)m4 Z6>biI[` 'wsP$-qG:oHWL[ <;FDPjnh?߶eǪB 8AIRO[C*#D㎇Y65kwjӶجJrJ^ܞ|eABhd^Mxm;ȫn^{R䘪{6f.hH 4Uꖄ`Ip_#i,U[㼔E+[ND)u鎪O锤~i1ȡC'x_+iTw C;G>q;ZR?;Ӗ'^f5Jób74Lu?sQgIݫBKiW5t){L:H/J5{_it-@dhؾ+_-]ݸ#MeDy1Va0]6ݺhOS6ೲDr=I''?4OiU(\ qOi1b`HZA,}ޚF>2uVR$s2ޣ/A;pA_6W]FKU+ŹvaVLl-BwcQO1EYDžg~akOZ>H>^WyWᩌTߒH{ Au D:݈ Ȃ1N("HBߛ ǓebmVe/ uW7|${J¤3&&4chlY+QU:)8QAT"Y*DO"O c )[ʡPgsUHItv)O!Y]GRUR m3&~+7}qp`=b/.إ%8gPlf[ _dN_ endstream endobj 4 0 obj <> endobj 5 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 6 0 obj <>stream HWr+z)oRS%[(1YjM?!d,r HN"W q{W3FVv>c|9ɨBxYS/cI|~y5\p?moLL=d8x/Vf]ZԗM~AJ4 `f R1|n6',eG?M/f/nQJ h{69 }A@Mhq񖘐' 9OݛWF G<y ?{_$8IBjFM9(Qsy+#I}eP5qG= Mb+ҮQe!4iZ[NTN(!SFYE.fSycbyl$ {7A$,97c4Ry*<[UWI "aE̩s#LZXFիӥI+W\K~E6q^m 2za5\i- YS)\|Su6Ø2K%ք m '>;.[Ɠ\I5Gޕmyר[lE)s JWB]{,3kdreDU%dmqx׶節Ԃ< mkEMjU0{'fQokJY5%ۚq3~N`a4jbPrC$Ҧ`U ~k !6QMʲ+%\oDA:N(Qr_^`?F=,ސNX Nj2MֲɹCd+ˮdvMYwGXj%%3Yɒk- dDį[AmDݹ;вSHQ}{4]&nD0 Stڴ1Uvd*UoB#\_xKz5iDHѮrU\k^ɂC%Xg}aFEG7slȊh- ]ȁlնX%F$h}.CVeY|6 K-~DݖE@QmvT{nt+0JR_]KSv(U/Jc| ~9|ØitJ <(D?ޯӔFa>\a'> qAİsC]xkUl0EdcukxPUWݒ,Y;حhU F3q9Tݸ;Vk~}IۮY_8t~^lK&k+ . Qh3xNq|,:{߶P& a$ZLMB3s3 bl, $`Sc@2ϟiRvzFp7~~S.ËY &wxAaB72Cx-&ɉ"ç,~e>o38Y0< {xbD4e~fՌ\5č@.Ń%i6`  7[kt(M__b\Ti߫QQ?]#Bl{SύQݏȗG `;-͂yߞHV4S  ̊x4 _1(rܞ((qQSJ |~!N҇*J!ڳ3Ř"9']f63 ɔ{,GǍP:BZM4 ŦvmdQr̐x-qlk\ R2؁)#ifGSmwygE(iJÇf:2{:k}+; M] i[]pݽ]7KKAix~R- "uy6"\ q|I%lBxƊdȦjMnBx*[$2I]7U%{ wK e6$Z4ZWxnfDd;&L2 endstream endobj 7 0 obj <> endobj 8 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 9 0 obj <>stream HWrF+z)MmthTXf5Yĩ$[,)0&g7]󪨖q,O),L# ս0X@ !3܉ @g, 쫗z&=PՄ7prG &$,m&QQ_(E4fgἪjN޶Fd#|"9Vۮ5/-VjMrAX,J92Rɚ!殪I*kEtI\E]mHRdS!meoXo%uACMKB/Y4QnlkOB!1x1" }Ѿdߙ0G'Llܧo]KluHpuE2Wl BkQVW,J7mUkŦWiAW[$%<9лEHUaOy/W%)UiL?UuIdݎ+s%٨CUVUvP"RQ( d)LnalU4hvU,1|аw3XPQ bXjmMjiUջɒd sGQi\^`T  \EvȎsIbAe9B=aany\xMM(#Ao<=hcFhزh*h6u(:~n蘰SG{;&F^UKߐ੟{ɴ &WČNW?^QVucѼL̜GLJрZu)*W L5?¨fOl[{oN34:_I؂imPiJQE˵#mH*>|(sw6,j#Zl d~F4! \M_+l ϔ|b$DYI44 F"ۓ|$#H!]?b4z Ǝa {3Lb#Ornu]h U5' \vuU;F*P(Tq'\Xp ^FaBԂSv\3V]3Ȩf] UrԱ;޶+ό9]ۢl*<:Kh^ !vx/|G>n#8yζ`4,44Qgףxvv3\ .hRZ:D·d!.a0g#rDiR佑Z%~,hԺ&7V ?,N/uJffRT ZYD (ap溒eǍj' 3vgE-qiLI/\z/~~*p[䆒Xļ x~q什ţh{DࣽE(^B^֛J =& =^ϡޱ6h58A%ϱal%|wuΥHe4h ya 9ϐ!-LQr(RNl}u3*f+zݩW{[I c/+]Uݎgs̾sDP :g]ϛ~A&OKM/@85JޞAN7nrWVO,F`"8Bd<}9KbNlG(it X !Sܩ{>/Od Ih'ZA*͞L&y3)]\z& ErV:5!Pp-> endobj 11 0 obj <>/ColorSpace<<>>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/ExtGState<>>> endobj 12 0 obj <>stream HWr}W#"{ L*Uc{2qD+$X4(EyKrn7M""T=Wыl1fQ% ?  2RQ|fus>xw"6RhjW*Sb">V03{dC$\2"#?fB$"x4~x2zy+9uH<=V rqBz=;Iny4v$ط# x[8bϿllԗBsJ#\'RCu&JG(JJZP:z%mfE^XgdYt TppH|&uui*flcOws6CEvU"^`j$3rR|jTӶˋ97~k[V%bESMn-k}Z\wO \h)crq03 f*F=E X4Z4\$IǬ?"a2N2Nb؄4ie A$01?xDsh`<}1}˅ZIQC00蒮64*4mW[& PE^7i ^M桪VAЏ]k%]GF?x )A )*݊>$e@RATM =X: bɠF ,$\vBy[L뺅l|r -_,켪Mξipo"T LX@^q(4G1V/KCou&t[97rDx* K"WLz0^'Ia}t∯$Tw*󕔃b_ܘ(N-+3;GͅgKF!zL!6ЍrL%x)ތ?7C0tUaHp U=6/"I^qN%Q3wHŃ8 tzfi7PLd8ZFB4$ÅĿ/p;Lc.Mx}+O J71<5 ilwL:Տcc$f|HO;gu0:T¿"/eϫI=@ގdu.&[n,q`Wr)5;욼 d]$q@l̍. 6=7MSԷKeQRkj+v8{K"1xZ}ppOMoXO x)`jGWÒն,CܧzLTH4R!4IaD*U>~<09w`t3? c˳y4ifhJLQ29Jx#3,{X8E:">^xDp*tM-^ Uoe [vVQŨ̻E%QIl;kBt'_ lq=i8Kቊ/+FB>/Height 297/Type/XObject>>stream &M<ޞ|?M7_W_}/W@J@h0,3s_K~/|~ׯ/_K|%z^0+KK aV@GȄ~ Fb JAZAMooڷ^? n_<D~;FbVaoA&K 0[0M<V,?[i oY  A<`< euNA@mao^An m&L6&aKM)a.TAr ɯ#c-[z m7D>}/ x/I#1 ?}&H7 A& 0[o 0S" ~C%oi qBAE /dC ߄~}Su/_m{mn6ޡ_`0n`+kj>{z^t7i{z^^z^Ⴥ :/FZ Z0?_< /|~??NOo__^פKi.A-(a0KdlB  H` endstream endobj 14 0 obj <> endobj 15 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 16 0 obj <>stream HWَ6}W=()jo T:AM:hC:hkRUH?Kpd K]9Orz H@YNYqAP!I99Y3F~fˇ~Ep=`dYyWƣ"\Kw?Xmq;b'Ua$LsN0uDE>46B.r$$WPΧ<:YiN C}+!\͔;mH!I)תAuġ'@ Lb'sRreI2)B1SKH 6/@#ï궓w#$V% .8VbZZ4;)wdN Xz0!(%*`[ r$Ht0/-( `폨AMZѓڈNڹ&1DRxP91D-^#T M1shx(N7f 8xe&~h,olkiQa yZAw*y6Mi )Ɂ3mu,}Y*/,gv6-Щ4”h?V6Ցjc谮 }yCV49!g)2/u rj":Ir /a:٢U=>hi]!UmjtjtqC'Tͣi4sJ,&4vQsd>B$%mSTT -3)dQOG, S*;m.<6&/5XX{v'Dn5 49Ac%qmA\lat>HSXm=3726nējAvh==*ġ|mXg t Ưt?3}q`ommۑQ:PfpX]rvrA1]lylvaLƒ@4`OժJ+.Npf)v2F/W;Оr?yfXIbg Z}@-Ls<6˧lFɸpV|;6IKoQrH&jmaZ2GK4FrZs [fmub@Ff^ͼ?jG4|z|O}"\ٌpǁ>Lp:9[. ?_^ gEhsr91,1! F[σ|/q9 IOjx4V,wm2G}F rkd479'yYB`ZG8MA_ d@i!gޯn@{wBEؓQrn+3G}Rϯ^)MpL\ɚ }[-&﬍sXѲ&(yZxyo }. 8&<'/oq)Wl7yQOԘ]u.JZ<##IߑWj0&e=2!BES\;rIB?#2[{$Kq8CК^12TGҠi8ƽz c#G'D%:Or="BeQUḴJSWPT,_kuN0yۢȲyͶzٯ/fbxul| fsN<A!AQ 5hu6뿠Akst%q;J[~GG V9X0x> endobj 18 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 19 0 obj <>stream HWn}Q fIڋ$[1kj ŋ㿰1fsEh^N:U%vv=[,d%O9#>KOh@"{ Y3Cֳg}G-Ż3g>Hیln|PJV:Y|1Kb╳ {g8'o_- {b/uo/<#'̨%g9g^ăPY?OK1ݝ3J~_E!A'h2srrc|w](cql3#bŁ dh@L}MNɯ}.-2@ 1{=n`r'[խR.yPRj*E7*#etԙD@99I;9 z\fQԕ=AVꆬ"y_e llZڎ` 8G,v FV548|RQQDa|<NUSDwJv5M0LiӨ*N# ,e5 WT)`YFz{}O.ij˛_T7r/FN}1y<>ĥfs?Xm!CGd yn$|$jH_lェ}O]U fzQ -Êxjrء60P45USʜ}UcLiM͉PW4zs oiTv1P6/ֹ\ZfTzdaQA\:*orK#xLۺHۡ@ClA . #ٜEȋ0;9&p⠾ ֠TTҔwEF,?n28p{" GmŎ3SfCg]DveBs'zj)'- -h;G)M͢]5fCJCcV]@@o#ap omdSwV5c9s/HGw y*mb7 C(abc%3Aٱţ!c)d,bەh>fY]gl^o7,uG׺6gVqe~EԬ\`)J_7$PD>|.iKXBdIH& S(F7ih9P7@7&'f)G'785/ϡc4?/2(s^wy1ڟѧ!y%;ZGHS. "|v8njΣ1  %0v p0='_F=dal5I4 C,Sz2>iLP@I msMGj:Vb)2o1FS\x\V&-dZ+BAb܉b|tKu$ӶU|'YO^b Rͭjxl3ǁ.b\)[l` ޼R\7&Uo#;,ڄVp ]$'Z3nar8~KSxMb|o@:4H5,@ܒ1/Ik5Nmq6s9kYaڄJ0r9dcoJɟע3d_@CYXOajveoIK U-wꕖω+ ]"TkZWoD*K Xdoe= i N󇩙_1/.ӴciӅ5&ͥJc|4fH|:yRX⣞a'ŨÄF lۄ(ShEL*ͤt]%`1 [4nlŽ<0͇ 8Esz ~zЫBw8AR"~Z8+SFQRY$,l+Yl!fRi2'#,~*S. px |@O6'I&i}\ޜ}|sS[q~%ջ,XA endstream endobj 20 0 obj <> endobj 21 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 22 0 obj <>stream HWn}c;5$u],`XL`wXMvtqy/rx%VŪSN߼H/nV7#EDY ſdqтDpqdYЈԋ7za'7oxﰾrdUj$cTF8N2N9/B9HZ@+.|5CS3~ly*:6OUzdGnd{dO9l@gLLyyRw\ʙCit\ʾ+05EI^قأZ(/X~v<7a?)4!YDq秒K2,ҘdqŢ(^>nJmٚ~Z`*EGAw'عjrߢHPt,WvJ^nFލc59UqBCfntܷdїk }%AY5ܚN']28!c?drA&WqSB'E>B]+Gkjɣ#$AB<{äV۶~v``vJyVW#O2=JCĶ9ųW<9Ȓ$a)Yr4,fc4P[WgY +O0XE HA}f}ͷD4G+IfeٍN`nB!Gh487ViZWc慴uFvU_8Ekv1QS̶@^46|w샄Rv@̏XtL'x`«CuGb>J< A'I@:t:SCn&Ʌ8,+/S!Zv_1 5= uH)TP UCh{W *,1]cm=1;8y0͕\Dg.U @I\3I4?RU{Mi-\#cZcndm@/f3'elRj/n.W3߰:=KfwE.$jj 664׸N*4H\_ (vh  ^ul > xhƫTrS)P<%9~QD"Vk9beCpwWiCPA$cb&PPn)9[%{GYM6egJ!.^́W!qFi8C2HسR-Y##݉r sEUVaQH$0 \0k`\>ӖaPfΧ9&ZC Ab.B Gĕw@~rLH:f7ͷF?敍g/*.h\dsx]L QID<{IU'bi%`2Id^M6Wi= ke)L;%1P~{R<Jc@vLWvtOX8FH}]3HĜg9 r$^P8#Rc Rվ$6""Vp,W#&jBpOC9V$[ɺTc;pKJ[W`Yñ>M߸#WN>8Fddj,~T`b!GoyMA ,9ɯabjZ zZF+3&3\rz56ޑjMF՗7 =d endstream endobj 23 0 obj <> endobj 24 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 25 0 obj <>stream HWrF}W#E1ͻ*:JkVNFPI .?Þ RHe >}knY:z!, 3RȐ{,=2azq?v쇋纾agW/G_q}j Y:O>KFYUY.5>\&?I?Q~A̓XII_9l ȇ1|{ k9;)}3O`&]+HIɄ 8mBB:O%A" jtcy cŲQlJʦًrɪEa/y(*Vٕj\~O5Q} ?1ͪ,[N* >-j\WlfUqM:6/JV,Y3`E5{]d+"M]KrHzK M a63.r[ {9,k sSf^15=8]!SQ$Jԥ.rV! wY`٪˺4UBY޺h |O0aLm~Ü}!2]SU)-R6Spv,*Z%27"Y6`52ecv C8ȋ2ϊ*|ZLO PF*{:Pbh( Ii_kʛԔHHdbǒ*(@`x8m@ Ľ郉,[LݯY쥭C;H9kE$]L䦢\wFC^3"'=c=8єh*.`Ap϶gƑ^C.lr*"m(3{^Vxaע]Wg`Εϗpt~w#n@ħ1fi/ns魆HR}wz?PƁ Y^dηdSp N%<A'QIQDQPS!VP 5T bia7b"> 6ci64lX0K][ܖ0췙A]Hz?W?eلœIJU\)"d]Z/bˮ!f^8܍fZ]!+Tu74Tx~&K8u"(^X 5 IÅ`Fc&#⭰*zf mSW88dYhđ(I"Ճy7ͧqXwnq'ǘ;(ՠܾR+TŊ}vkEά4w88ŘfNt䡆y7sQtj[ (!0gդL{oGr&'@<]ؓZZw>9\` YɓF0'NNm.]lmwzt.8ɮPP|teݫg飹0=)S/i%](;ݹ,Ah.'^J,"N=q4 b.{3 ~Ԗ&4vsxO'QrX2(RܛDVak4_<09\u!9 *Tb =9l FotG+ꎯ*NѱbϏ}>{2xx:]gҶzL?|c8 < kMZR`%Ǔ F7нڗVTևLĔdNu~_XV&-t9T˂e"4xn,(ݦNS%V(0j߄Gq(FG9NMeqƗlےMG*M[TU,`"#C2 7of%C a={ˡK VP;(/6`{!F ;YD[,eUw8RxAβK[Ԕ4lZ]լ #}).Rz7Q P$z\][C M&xm lkhɡsD|es:5[ر54̠ Qࡱ86&>Ƈgi#foDocm Inй3`1qԴo ;-z: 0BC +|aԼo ^Q<8HX d)8Eڋ!O"gBRs^+ٞS_}PFvb^ֹD3fCFUGf7ZVٍBҶ`T+TLYS:`j_U1zuz56dX8"8clsPZ)'59kh׳E }ĕNyJ!Gx8~$G61I8{ӄ>Ϩ:yi`S%0> endobj 27 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 28 0 obj <>stream HW[o6}_,lF$un$ES3C[]]Ck"x<6@Ln;w7ljzbfQЈŜD^HiT0A2QEAV"~v_aM_`-}U՗ŷӈxROw[%H髿;/<$.sQʖ9(ʱx&8͖cKSힼyE/ї2@4{S"Z&hz3x&hE$ESSʻ#`D4KOO?G_4Y3$c1aYIAy|X7/u~4Y.B}YڗV=rGdO~vvп4t#SNӐ,Z,)CV=8EΌh̓#<{zI5v+`^n"1K¾ϯ.j-%fCnTֲxd9,J"9:P6#Eu2 e;< gS/CvDassR$I a8 +#ѽ LUĴ.~4j6/ܙ/ȗF8,QDySȐnUתFY{Vrf=өAR]*J޷ߪTwT|QWLhv$nMG:FC")wXgv7PSYD䢲MQLLvW+wc!Rv :)9f _3@z:60|}gֵjzJE4F%C=W׽ۆTZ圴# ibI"7w\uT{=nPXmpDOؘpH}woKH̐ '4 F llD ׵w֖l}yl_pF y~Q$yNp/; CXIY܎A$C#Na8VdwV]p]- @Ƞ~o.c=}G4 mfO=t 4o@j+IȖ'3v筁sȽNJȏ <C$LДh<Am"3"aFާoO@Sj ?OsD$4YiE͓ %qYsAa 5SrD+#=yP[ u 5w? i O)`5vw*?ȀnQ XC)uxWv@?óq gܚZ^vaP-@_m 10ts8kAo[;_CФj܈sO8$Z{Fn">$ e,ONĦ%enDZaYM5E7c-+Cum5 iQuYo#U'2f ̪=A z:(_RmΌ݈(SEӸYg;5B.8Pg w${کǝ:rgifBt-tGn?c |c>\#3w$`to]KysO2!ofns{ y'ޒ|7lN XY9{iо%%oj; Pbf$&)yVUzjkֺuIܼ|zuΪ(As'Ro>v:<}C@PnobG'PQv5⛘u(q#q/P,̲3mVx&Tc F*[7h8Bs@D,鹮F\`7l=(AqAlib@Ï-{EV~~5ݛ ,2~Wf߃3hl]g'?AW{=.8@!*^ W:f5ٮ`ι kϞ^^#XOvL{mRxWLbN?w߮^zz0"^-b580PrDh([l'g-v^FiTޅͨ dDeRv[HxC" Iᒐ|L^kSuD`jr* xL4k5p|`SY*~0/Ӗ:34,O #p#o*LІ0`Jm %0 UJ*rgn-'B1QP A/;ymv"M?>r2d!%JNVvP^X<ˎ=NA0 Y!ϯ.H?n./GRQ$A];_S&/tqK| IRN[zqB8爌ޯuEOq." s4*ۻV d$=A!PvXi$*z HD/B gz۶~s")TfAֵaؚ#KYʀ ?u$ֺS\` IwMpThғ04#ͼueEה̝t1_7@{wd Q=[uTn^SFTi]n?vgލgU>?ȯU2eWFH33'X >ĩzoZi0Z"2O r4`%|aIIY0K>Jh!o\ًe~*5}Ȅc^$E9@c\I"Si X-?ۥ9vyUm)rcJ P )@%3Oh**YUCISo#^bC߳ H5;ńS}1ك5ϟu~o`>c 2 )FwjBgU mt0N-ՁYx,?%<"BLmϗ.m k=w&^HIy)J9Q'0,-gϛB^"EB:gQNrʠ?nI#d mo#KMU$\v`YfA:2e\chYX;r6sW\8Ⱦp__f endstream endobj 29 0 obj <> endobj 30 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageB]/ExtGState<>>> endobj 31 0 obj <>stream HW˒+zI !tR؞p'R Ct70 "M ;-r1 qO^ d8ɃrFBK%Aӈ, r2o&a⇬&/~G-7NzfIȼO3F};I~M۶hE{3xYg<[o4 hcÔÜЌaL >yû /&4 rس ל QD(qۀEĸn~dvBwpWiLv8ܓdo*2)$)G& ÝzTB+d#"K5L;uL<)/iӺ#W#c$`נǒ81}H&|)qCtL )IX0}]ԛu@ #g U"ڣp5!raj#U\h+WJq1Ni`P 8V"('g `#5"x0V3:ୖ2H>c9׻LJǧz/פ0q. 7;pq| f_D-5Z~טbKgC PHCz,Y!u!qv4Ƴ}.G2=/0C8Ɏ $0h}M>N_71ڃ4'q9 X 7Fj@'C x|[]K`i aAZB#bЀ!OcӃ SgHX~sxt$s5(_AQ>Pk*BN!y"kSSpHkJB9-jIݘA ܋0LjnZēPz"ڬmpє>] gJ gn.])BfXA۱nY{AUwwR-ǡl_[f<+x\D-͘ 1R-ĔXQ p:qbK@'[t^s0p^[QBbgz\/Yʃ8`fc,?nӱܦp)@C(.IJY@#Ö_Ґ ɘxl^Mg@ IX,: כYCNP֒h%] tJe>Q->nk*K^ #:/SvsQF8bqt(- Owt\aXJs{ R; ̮͞vx9+,AqZ"3闆p2MW?(K}jPZaDI4-QNiVc*Ti"y6^LZ~J`; ʨ0gkmΣctБO3}'x5.C]$<on1gǧ`$λE<=pf'g`*JcUme'%K@},͸7:h;)܄a(x.Y؎uJ@k)E 2A {t?m̛qy6;Sb8I_{xAe,J485wmq[ܫ1$rjc J㪣Jgc]fA'aT@ Yh㮆xDcZx]VuM`_aO5 4vLOgJqg# #渔^1x3bޚf3iu]Xiė|0UƞFô4IfjJkTeм51F,99c ҐyOVh?T>sʙ^|(-4jSGIpBߜˡ\- .f}?/~jZؕ%| m a:kJ'xߤdM endstream endobj 32 0 obj <> endobj 33 0 obj <>/ColorSpace<<>>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI/ImageB]/ExtGState<>>> endobj 34 0 obj <>stream HWn#}WȋXl.ZAtzAA@KZ_<åJ86 YŻ{Oɻl '夠'0%)e$ ! 2&2͏Efslv?0L <W-~Jq&a>{Ds/ :?]i. IUNMc9vȤݶlV{r{1 QS.)`Րzbg( а#E  ;&|%_";'w䧟Y%d< UDT$rrBB"IB҂AW z:moȃqӤjf^#Y ulJ籮-YZ8Xo0ZByDj*i.h8TfOQ#ZYL%A; tZ#]͐C#&.S5pkuk.|$F}k^9nKtn\e c%##CgGG»}{ +ga@f6;h tt't쐯췭3Gi)"RWX}{߀"9VƤ幌 qFtm=.$dBQEgK3y6gl70JFe>]ah mI4?t ?$1of jhwضC  ^Dͦm|mK AG6\m +79[yz^z{i{C v'L8% Iলمblz 㴶@ubY:/o7`~gLp4^hOvIɡ@, лUY,;%Q%>_?WjJҤH9N+Mg+-eT `͐Mف-Q͑ #4movn}\SX,qLQ}2Aӳ7_Rc\SH@f뎝I3s3Ђ1 M.O,#f=fB"j 9`> ?*w:5IP4ߓT_"*4@.|fRLcWnw܁n@̿zSwGAH؁]Lf]_*ěӂ dqΫ ǔ<A&@wC[pYC Qrm)n endstream endobj 35 0 obj <>stream H{egP.F--^?ZbԨ4Jl6Ђ"bh!bR5( HؠJBi=<>;۳{9Ϲmgfg<~=}OH(_ϐ09~iӦNZ}x0<Jxvå뭅v4-y8o'V!"#B/^0]zhKQ;@n5Wiom[.H/̉ׯ"gcd/v>`qEos7%5)yF{{erAC8K4u:hZo=-msP46. > !;9yG}%i"A叺xb+6thUu_9(m$}!JK٫Űb3qFFuG}L\պGPB皨a;.JVYovKBdIuiœwˉX072@+t5?Z?4Sc _wirB.Tq]iܚ 6PJM # os$3|7v懖9k;˧gi|ξ˿5wk+ݥRͻ{,d3xu;Mf…FGW{*yս㎐$}vu=Xcw_+Cdlm]=Pc}6}O삡GF-> ;C,|{Sӎ 7ab1ڼ5 lm\~v\Nӑu`a=|Ȥٍe#oZaQ?I;aoO Sئ.L5 <10}8>~߸3]>*xMWX`&o }&tF{z8I(؝O\ 9hqZ]Cv6=v6{ u ]d W/"ܥS.!l C$eQ6L?1P|UL: dԵM u6P]Je(Qխa;a~+C)-1{4[s~ZpQ3aJ?vW#䀎|o?QEd&w^Q3t;-Ȓ7GF2P7Okq&IxִOuzJa~{\$MM-!"2?aۅIŢ?v^YW #D3*#nq{Vj\T:{A*ncVאWٽw+2&G=,nzm\T+y+K}Zzub8嵺xUEk}*X'r7-:9j}VV,C|Ug>=ӾVbgJ/d7lMv$H& `Gi+â# mUU м$( CY a'f#￷-ޓ /sν;qu+rC >XP8cso>3oEVvKIJk -QLxy'z$m!J^'N#]4[ܮ5 'c+ZO~\CΪݵ#UEB5ڱu|'SW\3?(6#a9WЅ)Φ] ?tgC1}[swU. rqDӏ١YpcuR^$:F[OmKXlºF!\l+(RaMy`'*[º 2)metB3誝=I^SXcXf!}bL\yuqR#iͥjh\L6cqr;{XΗӸƃcM5yuOQFuR:LTT̀MX3hu8Ūv;k-0'<>9BO)Z|ܭv:Z/ب:]4ֹN豭ι7+4fp-  |waqqy.t:¡'huvk}B󸼞 0OUzL8 .TXZ?i2+}V&k "69y.ʲLU G TJHSbo5[HCvk0wfWrV0Y}yk6UbjrFoge_4E un/癪聢s(1T=9U|+9+LKi:qnZ$\\> b{j߂qLViy3 9X|OCZ +@|fؠC6FM#Su0k&Y//iLRYŢ(_ԙt5QurSBdbBB\?4!aD|2_xҐ+II cY 18vDԘG q@~y4Xgۆ5Dϖ!LF Cg qlk1g$-2dĠm搭}q1bp~ܔcBT-FΪ8>1 wXۣ"p _g񸔸w(\!21ewT>]5Dν֋zzDݚ>J Bթ}Wʍ"R.ҽi7~O&%?ghXN,SY  a2HJ4a]c.05{Y6s :OH<K)d3d;a8z%yQrX xZ=[ܩ_@}":NnZ-?-.Խ>rw?My ba8:]W|S5|d]W9À' '; a\e1y~UHn1w> 2uG]<| gMT x!=?ږHU, r}#MFg[Òh:+aBo ˿ O^G2;b[tX&{5(9-u]3@iK бLA-,s7Hêmk@H0gO2;QCR/ ^Lu6a?`2?Va܇~GE4Gy{kbh Zbfu`q.@):Le7@3t{?g<es)p߮%D},]& |ڟfױFgen E͍IM;i %6C{7,̦ͼotٶ+N$x:SD=†v~tQE A%1 1H[zׄNB RZu1B1mbus&w/WͶmBq+VnBK3o1@c\TEs@>Yĝ^1ěS`o-eл鈄aHJ5ߣB(?qܾck\le R`"5Sfj3Sy{ Od>m/,iz]>q$L7S]%ݘ觖jVP~RPtR,F#%Oݣwf4fG,FZAJJ o3(%jA4|J6#M mXzqgxb0>lVy`uKn~ Y.9!r Hע"@?(??2At1:dtBX $ UL ,/r 7k>uX !"z'gs:OG{$svĢdsBW'ºa;H/|]yٯ*+|&7!@P 2E[A[p4 c!ÈmQAeF;TFJ*t [iĢ2XPJHI 7ǽ~^n¨!A(s}瓩Ed6{;_Zkua5wY]KFP ~-e0ܡr &֠T~MD@Cq.#qgD֖Z ,V}&c#Kd,zEIsS{m3BuCusR͖0nyn*\|eYysN$8;z\$ML-5=U׵;nAˠHQ{\lŌBC#GՈ x!@½ ʷU*uR& oAzT'qz,ENGN ۖ:'}9߫ao@J|I_ TmBhQ}+}߅ jk|4q&ѣ .ǔ(ש\'mg; 5dusUɋ'Lu&exZ_\fM?ZVee Z; }t9v\TW?V@ݬK5#ֈ Kdp\'흝weJ \g:zQq[3^1Н~ W.'+Z'{Υ߰j;)d3<+W'VI_2lvk:.2"eNeђڊw p'ɮ;4\+y4"뀁Ow:EJmd3>QN++Yf#_돤PŔItHh;]gy, #Q=np ,-Ac:kt&\Aǥ]Qf| \:SIKp寋vq E_XA簲7р^R48ʃ؟.-?Gyypubk{R' X}lJ1Ha1T7 n,{EIE]b%"Ԭ["I Q]|[4kD\[S`ɤO'.B+'ĞZ<-i Z!Q 9fqVfyH =m渔GXu_ aW{/b]5K Y#b9rdn}s\Z׈CL_T]NDrNArj:j+L+BO5.W<~mv躙-^}f]Ɉ~YgW?"'2Euuh46YW]1BhϦI?u%oiN47:*w!'z.jV9af_Or:[UPӺ ʺ#9 '*ru+>(Kn530H_n }Cp?ҹ0 Z\?{oh{<=zԐ ]`mh]\a'G-R+;UaHt2Q!ɉ2}•K76cx;V_er^,k8GEzhZ?l-ÍɈc,GTw]-ڥ%nVq}&KYM.bSbTρsoklMkb\׳ƃ.l ,VCicWFLC=2oa-tW]濁yp=Mr۽]S$`@i_uksݭq&:*B h+nQrp+'MKa8}L:հ[  s&Nv ѩx3RgL'ʭkURAIFh4pfOeQ[uM +_ϑǚΪi 乮Ţu!D!f[zy1P%[<<׬CCdF6\)׵[[7kOzEZGJn-ep8l㸍z,>F]=Zч ޮws\]i ?q\'@d$?OEBCK8E^YAhtp]8lwDg~Dq]J^gqѕ;m7OaUW\ػОLF\gN̺_&UWdI@ThUiYDr-*aQ-mZT =`٤,jK8Z<(U"aXDB7;3{ Oߓsf+xϚEֽ>_X0M~/Z`HJ$YXbDj^2 Ie]ۊ&Z7.ENֹbsLºk5{ |Mg2t_UTXGq! 8PpGTߦLK =@ Rt/v^LLWsdrO 7=L9r$)r{헱Y-;[VmeNNGOq#"X9.1 ?} 2Rjwc#٦vg)Utڎu9ΒEץ1K.y5u}PjVVwGnw7{L M&COEn~H^TsUt s&&s=˕Ѭ#ڦm0 ]EBY/z7mNq5fLS00m"KUNiI:Q`;vd)(쎎5`Ѻ.-jxrFyүn7敭Il>|<\>dJXϒbghjuZ 8 .)?w \5|ϼs& ȽSq(uTu'[,`PNnD( cig3v`l/MyρފF˂J/G(A4;mC*#\<`9RZooF,uvMH]Y4pօ:J-Dw2鑎HHkiM0*סyvG'}j/7`ٕ { {Wݢ a.sӰNJgjDDiS: : y(4Wzt?S`qȥ0Rnf|gCőS^]6O߷bw4:iJ%v:kOk/D- % Hּ7*+HPD}isN_т$"º{]_M G46^Bgm/<1 27qu6Y9E]k,E6lUlCh~OoѺN6IIuh_@4}XQWHJ%D`e)_%6uJ: ȓ1"c]TeЦW|e:H,&vڏ&5Iu8 LQ)v ql N②/nQ΋#eqj=99i}pg=bW8(;TuS2E1S& qxXjuk;(S*8x{;Ǒ+*W" $REe@שJl!r[EYN#-Uuۣm׵afhdzq;,)q}%o#EuXuzGW.'#σ#Ygt/ō,|S"ST# Z-ߣ@c,!ڂ[ZXnbzZ*ӟOb)`*,MQp\oSFȘʜvc^Snv:ۖc$SX'x֦fNQvK!a^ΨuE[:MHG75Ee7eoH͡9F XG#u%(J| 1QubVǺaAarT7pWeyy*[oYV.p9Q'Ïy<E3ŕc]XYh>\e]1oYgϡ@gy|R{Lge4&}btgu?TGLHD`mRj!/ٻC,뤝Y uuU/~}]'c56t `pRV_Yi f i捯N tD>4m˝xoQRr7]oONқ9%cP" cZc!] r+^A=&:j 5YI,m%kuo҄ۻ b7} ,ݖR^U\ 8\& Oz1;s]$ _3ne_맰Y<T'6<qER t{!\T9-<Hh|? ;a϶f/fxƼO6L 8s7$˝ة(=&nfIEPFe=#Pogq{C ]ONx4e r(!26k>ǖ`AhpȹX&yӥM?PMkЅB k繅T;뎼Gu*p=CU\\ư>gᇍ p@W s|>_ƠQo7NLHO}|үIvo%Hn5) gWVS¯Z33"ɛ_Pے5T/%c!Y1`eD}vxEeԴ(Y4?:-,d;o*Cj`|8Vf2(||oHtHk_ 0b́iC,=S_䴴I $A=2yoϗCɯ#0-g1zo0|Q V~mA~Bk'OOe UG՚I3$'kFa)Ȼ+%]tI֍  oKLxz-A{nCCtP,=K7y}QF`߰}gfxw:QfLĎ4S.PKmLSh2i[XFyb+Iy>>- [EE'#At8(=decR^mY7o*\QUXkT⮁^ZHؕܞ3+Z-ZuonaE}y]j{jAm8BR2vV>L#Ƃ躏 ӎ^!FsseCXF5vVQ6\TPS/P֛OAq+)SDrW;K%[X1PPWMSbixu@QaQq FF-(>m؆[Lu_&eَ.l[Ϙ-Mc^='@6M$`SNDzmi} ؎87lx x<~?)QaΦ=vڀ$&;=Ik?٠l6LfYy6$m Q_juyDY_蠠?BN0U=¤l닄.:, !ܹRZ8xeSvWdUx-Uʹńy1q:kh4s (͆FDFݻ|Q^6c>EͰm$+PZUB$gEuoHw5w%1oe-)F7`F_XeitܠWeWӆ)&u擫MvChw *elfB먃PzqtJMPBņ+``afKi4iV ڲH=dKx= l#/³Fފ"r'.Lp75IÅcf&X"Bef!&gge$ ^9̪^VHd9cLF@Ub@Ȣ$X3ÉL2Z;Mk-o:I2uP֥goZ @]d4Ų; 2Ӂթ-Ol`{ tlUEK5+See6W63B6œ%(l 0Zt RpT%QA9e:4=S޵Kɥ5ov@ BpL=s3Ȳs 糡s @Upʹ  &4]lŦOs鈤*xt[_S2D7͍l[ Fc]@W94/@ܖCڴ.S6pJ z\np{Go~1sc^6b82c4H龞1E%ڵ $aܖW$H^{pGW>tp>X|d'mkh6v50)v\=)ndh̸X.v u&w?'لpF͏jtY`+̀:y 0o*!4.n-d9;p94QmmЉjۀ9J~Ū'K̉?:2i]1zYTf }c Vw'ڏ]]A}u';^ 'j9/ਮ*6@ &%(F0vlceA-Vh(Z壴SS:Ц`Ԣ6hd={nȲ;٤M޻w߾?ͬCggG*8+ tbZ;DR]l_{oH0$̢wK%PxѯAH-rs`ޠP֧b¯0ԶQmPȳ1 OXo}>nj]Q*5sf1p#(*r]Sj2PZ$Φ ow˖-[>"Tsb}>rz.WL Ϝ9jL#g:)|xwHervuwMkׁ1 tRVtDv&R%OR30u4~M.(ްD[t&K&b"z[l]Ǥ ͛5{w|&(\nWi&KM3NY?Pr'xʦ_c=0I_aE eUcr]u/i+632rwz *vFI&0/:בNKmO?jG/[ ehAAPԧ.c"׹1KuRbWuQ; ` lUoI3sddW\o GIA(Kת)*@Hb.L):VZUFnW #.N20hO\rY`~&rJ7(_HۨWRWT[WK-,_Kc-/K k{0G 1tX"o/ad4,|_oy a&(PJ Iz!Cιl)٦xNj}cxހNJfbl0ϙcSMF3MTQf25Rmb81_UV'yT믨/Na42Rd ϔD&4=%R7I##ڴ͕t̕ąz3z} v0L"ϔnR+ 7eG"FW gh-@o/whk#0+/Fbf[?ذaRAQ;eҖCc׵cnX wHJfGuOJ-Ӫؘh͹T F]y2{`1 ä6/%M;c?\lsZfn'FGӇr v:TʀL(y- ^IPAv0Lj 049!m"SrS/'}&%hQٕQ1ay3EE*"kgn8KMĭPǦK a&5v>Jv7"Bo!dF!z;Ya]wϜ1sJgFթ.(l4ZQUaR+ɮ߯k_\<7R x.ޕo s؅Zx5Lv0̕#:|R (:T< MĖuI0Ih(ja^CXvQZS⁃Tf%Eb8泠5sc7OǭO/|UEJQk Y}N11չή֊Pd: q)4a1 (-|dQwحvNB|l)H uZxL?cEyqyP# TiCAԈV(ֶ,kݵjLVj"i i4Xcm-mZB 5޸Śڄy;3{fggsf3ם9Ϝw3( Y@$wzn:U.,4X~yyn/ԧ1)rBz=d]HR$֭1?u/ M&?o[vŅF<};v?% }owK0垆pޟ‡BhҎeh_ھtٲt>|fy-+M4f߰%2klohe6ѱY _[WeM}B&LhW߮'zO|ԩwƟ[0JQk ܖM>_Ζ yQ{(,z2J'{JQO4e8zyM{zjes@n;ӓcn=!:7e8kƁP:h%EXtܯ͂@i+ޖPqi~iziM~̆RW:@!o3ueT]?xh_u'q6商>eM@\φ hz&V+} O2f15]z(Hru0 !Ǭ18|]o fvD];aԽ:Y;pCd]ۇ2Cu Q'5cZ5dݏaK# F}qJ"mEi!:2Fn8E.,lFq,h$̩em 3⑆gڐ"`84uq=pzl?2Ӗ!/5wjcYe2uҘ~BuY[v xu!&=6=8 ϼ{j<$ũ{tL:]h|eqK`X|='NdUz7uveuqвBmQ']4T?-'qt*r[5>:SUE_˷$@$ČSzZ5PZ-K_ede@siKtY׭,-G8Y'WݳCjW-žw=oxwq\vw:0 d]l8>YȺ-FC,y%HV aW\U6ccd/fݕ6k:I|_geuuJ Yik:@+Ywf]:BݗZ:@+Y.du#UGTY:PudȺfeFkvPPudȺV.k 6wD5:(Y{s^ul\5v?tꬺOHMvYuܡ2FRٕ@5ueSG}վ[E֕κW-6W]D@Ⱥ~,$1F᢬8-|]ZM&opu;,dn55_oN#CWuz^_YI$'&>;pL~ݩ0 O74w6OM1}A#Fn {>'.h>]xTŻso!PY#/뚉V1SC2{xpWN 4N{O>nc"?{N&uPCQU~S^s _yAAoQC4Ç #0T4YKz\c6ZUW/{BB%}݌.}]m2̻ر@sFb;I5KesM2# w }]!#:wx OY>[e8_$OJ[MČoƥM2#Y_CŮQ {raWu[T;hj#1L{&ΚCeg܍Ke2V@@;8j!kglqB?ӱ-u,3-Qjж@:\-Ӏ"L$$%@g@$:6&'{w{\n.N۽}ú 蟈?eɔnde.֗TiY˷u/P׍A_wcx!euXWO#Ap7DFΣ>։*cP|Q'VTOp1 .`KjYg/_ uN3Eo'RRRe).֙^$YF]ESC.ÖgY9eu\`bu f=NFa#ܱAu xv,["oiu":?&?o"뗛VQWBixTD84XB~$ZCEFvQ:JAhR),}]XlL fsa؁h #hNԁ{PRR@e!*1O2.4(71OfooΘ!3qx׈kWs+eחV纑 E:}2O:dnBֱܧ8vFoK-3#7'}]ᡏ( 9:'\F}]z|Aۮޭ_8#g&їq).chzmJJJcK|rvP*x/> `zy KښZYFtn å ]fCmnG^ }e%D'.%v3['{3ےp{OV% ̨r>"v9qh?aFw_ C-4dx)W M:JpN/_II)#C_בN40;m(gc4j#UK׭p-FjWf\>qT  ţ`r F-X~O(3tѶ  Ώ䗉0}i6EB))euDm e]f@Ctq! Pi^S_za!PYjp0|If`Cobb/{[sk:ϗ'X etr\rXn43nVcUViAj\tfz8#:|4o^#9nq| ':`9V1\9 [ R*{Y'{m.e# `T oMYcn'dP(u ϊ))s|Y퇶;DLݚ'Awi DXf'aFؽm2 :n())eu/EatO`@}!-hxXPhzfSB0hhlob%|AhXo8ptKa qh"uƸhho ?qJk 4)59=yKҧ,f ktL.c>ݠ{\Q]K)if?pOcMłY02o[ */μ̞?||Ī0[];~q twh7i[h1__KS[p><"h`{~XhrDx,+W km^Ҫeٳp{!2U0\y.*f{ٕFiCis;/跆>lp1GwbRmޏ/OB9U&G9aY'؜pa{MftJJeC\˥n[Fs:;vb;lyi駟eVVr -߃|j8Lqy .s LGF#xXp#B44c4uX̺. pqsQRR݀è.X`ݢsMm *T Q,4ׯr"0L-s\[^t\ng5c;K(>ݻ}}4"i8љ6!d76|<>ykGa/yYa?[+c.D7C?:\4)+3їλ  yM8XtOcX7."Ѽjioɖr_?i,%xbW6^H3y pfIG)[|%j*v׵𘙕>$325 Z]\r+<8p.=.̵!j؞%t(#kAؗtȉ(k3; Wtye%|+W"7޴j&eQ^w&ٹԇͳl-F|C5 ! hrNjȫh%v,SAA uWs;Za卨:<(ZZD & @Hrw$9I=gϞ={1ġi/3 aV;r6Z|%PB@nŽu=zp/b_j춴vMo~0hò"U:VVz|0ϢZ3'@(7b@xu5I4MГꜮ:_35X`cT8Y[`|IeDq0V EVd:I|$*'&:.\`=FڭGA ºa@n&Yb:)~%ԉ׉%NJi}Kaʏ lp$7n1GX 6?kXEӀ铧Nhq89#39h($Dr K>0X { vS0m3#SgM{P#sK$Fn3#,hm8qk8Fqᑩ/ E^Ԍ'E*ur~&5hkX+Ju0#kI^H3ˉ06`΂69 {~13w|dщk5#S#~E4 m|YAbPOmC:#K@ZZSʗcFn #Fc܍\;QF3#vBa`7יXN :܊'v;E ncJTx $ trxRy{]Ff@M$B" -}oCFk4\ybTIM4u yQN]yx= *xvzl[נ0O}PxܱMXSߎyV$'Er3a a>'͋wQzM7*1|M2=|u,/iX"Z UeIc_CƗ8i<v:+:}qWد $(_'jJ`X9,wM@{CT}!H}5Ğk f5H*mtQW@Rmy)p@:u׋tjdh> cvnA?W U]$,pΑJP&}{/-ZFa@ L[Us^u+uu^k eY?s_ =U[nV-Kڼ&څ? xtDLf#* ]H#uJ(: e@٣ ^T:1NbdP*zeOT!d 6_{)׈J&u*?C`:޵ڏU6W ׁzM=z-k :m3@'쉛G9QʸvX >J~I3QLE.қSY8O2eɬeC~U%11 31 mp1фXR3y"G dmu3)c2rdR<] +VSϿ\ TJ*WU/"Ǜ.4a](z7rIȸeA(w'$IwJ{󈋗ȱ༮-yݸ7XƼSR&pq+Ӆ4oJ'Sx,84M@ b @k< FbT.(`V֝N=TzP74 &*ȍ׉ mR)yAN.Ck L qJcۑ Nxj(cr3 GuVU3(S6@ַ k kº҄u6"CE9zE!K>S^p"D aTSmKt>pv4's8^_Zdj p[죒m1g:炟7OX"J- m{99tmM:n8fM IG!6Hٺ (q7B+Y8oW(5 2..Ijh0 `I1azAYV:= St+e @6kuj6Vq+wTdHj.bR-E^g23"DHHk;߮_Nr_V#( 0 TțMHϜ)/g78|-ۨfhCƟw9N7^Pt K:?.:cǢE{D*UV)2 g ]iQvE8wn}pUL%t7-3N.>{%~%(h`bMuA1YPRy.^C,(Z,tl%Էʒ? ~_zx2/W_`)X2.Y '!%@ _ɚРRU` 7gѨ1 7O">L=4ωuR6 d7㡧(b,Ɏ2Ryu,q\M+릶D22uн5*!;`*Ru!Q1Hώ#)$ h8@W- èd"鮄!d.m.17yNtf0>DIyS!n224M*I1bN0h5 (z1} ]n>K:DJV-ҙh:%̔Jr?0-7or?G!Lf3/ZV?~(~>G6TuޖtCk>vvnmơl,4WK,2z2r?Ie,_kxU Gm |sU"ZNLLep-HPe@6G79<Ә.:f7žP: @ uJ5\-G@ ߱ g>,P"6-gyg4往/O}Mt.YNVtH U(*.YS,,hVP$ #(ž\%΁|xqvW}0㭰Ν }*iNP5 2!_ ,c_-"8/GeЁut=b#C:;Hќu@Nݺ~0ƺ:6=A\q*J'ֱU SsH`ni>Q[dMuz "\r"5@Hcrv%pJU]Smɜ `4=ru*xD1Mv CF$to֣خ3d@'?ܝC?ζ1Nb1'H9v j,)mo[#5XoDO 12K70MsK!diDE7%:{ƴˑ;td==emD`4{c5_QUW?w74H)3"PU2TElgRqjPEm#N-uZHA~H % b6}{νnLh$Lڥ9w}w9ߔgcK07"2Ɣ|c5olA)(!Z*f':5 1^k#mH(I:1/'NzΆKx,4jqOXwea<E!}݉TItoX:s4ffRtH3}iKmGF!u?yU$Q]Eu|LESZ9"kzݸ>ٯ(3*bdkDYMjmk$zz;l:ۢYdx_C7eX=L~b;)3lw?WgM椷S_ө&xjQ.uєgzlvt7` Ƕ|v*G33%*iO j`GR9͝31&u*u7}٨RgR3l:;dDb֙;ױN6:O~~$^+ N^gN<8YalMH$8߸BpP|cvzY]o5nSETi, yBؕ_V*fuL=31xL%[2W4{8h* Pؒ_?ɡOV<<ɣS_saXB5֗*ʯ$];k״K V^B_Rn ֙?qK?"'ugDjNf]š|,ePဟ.Xk @Ke*^r CD37>^62BVי7+1^8[F,:Yg9;(6,>úKod]x^7A&=Ǡ`dex :mF5Cva]U6)yޱDzKjkc].Qk6=g[Eui'#wKenĐÕgb%1erV`7QN ۮ(WhHEMeYZ9bX &fΕ89fz2z6Xy0+n։t':+ŠyH% ~PXɱY)5p}V)"PR!2j&Ju)"GcXMHZTӔuF;ˍa_ =YГu]غJX:Ԛƺf7jI̩X9HpHWHqvY;sma-H'HuQ7z^`,4 XD%C8|qUϱΜ쳮Q<}y ,봩ܧe:~lY::_dR9>-x`]D7cY`b=^dX[w)|VuGFt]nY'ƺn1}*1o2.bL.6tExnѐ=YץbZyƹwa2P~x׿)yN*"uЖ9OCe\kuҲҦSYi5r=FOokqsH[=YύqtݧM#|0:VFs%z=&V"yn 2a1 ֩ 66 faXBO[$la8ȢO> Җ(1E~'g.+Rn8>>'-ZW='LbUVpB~͉x}lHZ!x'|C9X-P_V),gif=?3O)j_Y'O Swg B(XXQjGy壈Z!q Ye[';9. Ǣ\D=w4s*Қ0~@0r 4A uuL#WsG. 7ڰ ֓jȟ죝ؑlH#t8n ]cI{9xzRl)0#S†{ܳ~{CXb5L pU{s?~T!7fS6W߹ϻLe5cOa* alRMI8ɵ owEGY4<(8]0vuey$S.8pJ.(Wӝi"y_1UZ uPh"=_9 t"ޔ'CkP,?xTW YB؁1 v.0쁅bų_D Id28=rioF؆I HB%FRvi)ޖNu; K+(?FM .}ZI7җ ėxwU, N(0b 줙ͰNd?NәÑ8yѬ_r(0dpLQЎiC\$ΠYaIZxt'8`d80bfP=M|8O (hm? e]~Fa.yq0#E8EpeIv5h^ZtĎ1uN+ aQBwFLD@ݡga`O섊5(cS_zHN= YDQ|q.3!qM`a'z2cb:ؤ-dݫ1}]_DJw3v8_qʘ2W9`HX{1}~& ye:n|㚂9 ͖ol?/(mOf- ,-jɑ,iLɼ.#{T0p`B$48$YXwΌu4ЄSFbALpK?0lq(e{Y"KpRנ/ܰDEm\, ^0ns#1ZSC ځ썐MS@\hDxDwP؃MA1܆StL:5% 昖]"c95ãyz o*n/ਪ;(nT)Pv:6) HT@ۂ !Pb2bEDe@'(G' T[t_-TG@)ҽw;n6ʹ&Oͽ޽{>/u։ͱj;N7LQM"}﷖&v0DF8r s'(%^\Y)¤6E3ۋʍ]|Y[N:},Ə}nyI8u=dpMtcJ#:SIK{prV#Rv"*Mg;,.V~@QhRUҝv!n bDa+ă9&u;SƲzg.!c叽(ut$7ۗ'u`]t/q%e4gPnNd&ΖXG8]Bm>_6j{]r#"*WOf]uL@`, /_~]gԅ*Aki2@ST7ΤQd:mcavƇD]ӝ_~T/O2yڂ]gkRVH8Jh#M*Fs^@?{H~O..?똫eC]_;%9jDH8uo80S\wKдq6Gq\g;.O@`AGi^`A2Ɏ*e}^7O_wRr]&r94uL@Eפ/V]'lAuxGo鴅&6]g$Y/1n~p8:Fqh~.``vr)%L|]>,PGPsK_͂:A##Dơ#./똀t6.^;}x\EswJ45餖̦$~"PѸփF}zQ⌏u S2 @ *Z-cu2%ů!iשXS`V|v\gOu)`1L!®D7HuM![-DIM6?UUUuUU3g̛I*usUzz5ǴrYTӇW5wa v]F0'ՅB'.h:zz.*/&Eb UAaGrQ%Ͷ>0}N%aeG*WRYEꢖ( J7nHD+JJ_EeU9"T]un8!}} ,QkലeDîcB] $ө D9tj:'SJnQ=`B`1LA®K$cA&\NfRY-z#EGGXUd:;? 5lfͮ:)HuAo-5~TFz)b s(z/g+=+tG캼c]5Jw+#v~tƼ|E=郹hV]N')v]`1LA\6br l2kY)v"$1 `}wj&xyiؠO™jI>)rVt\CpK#C$lJ5ĬLKfPۆJN5mk}`wwEc] p T#Xu·'uȮc¢r݈ h;kY*8BtLR(]^;u(MiUVά9/~~>RZ8+p8\ǹa :( ד0W)lPhVWp̸vqK^€kZfŏm;&oBOhzwK@ fsd:-I+ƍ6߰z~P rLjz zV{!,m.g -X%=hi5Һ}J.\hQfծ&~WK ̍Pꪞ awz˾YJt)"ξ ܗTsj(QtgnZ)b#i{'!_2JRz*6u$ᴌ7LS$GU6aURJmY[P4!gui9il7iU5/7IJN6 moݐQ4 ]1b SFR8yCrk!\ŸYIs\6;m}AdP:иĹe]W,@uغ\u6b9#.fKy˰eف/jC\f[;ATw+>}Hk`Vjhy3->uM&nmT# qh7䀏c}l?@غqp%d._2:+~B@5u++{Ccsۍasg\׋ob''_^hn)A[뎫/v-`]2@?4uZ>&]nck׭<Ԗn<P[ZJܪKڭ)vԋ:u\̚ .?Ou5^5к"wo^KO6l;pѺԏ]`Jj.P:͵'mZUu^䜓, 9ѺZ7sz%vP1Z\@ouP9Z:ʬw6ZGZ."j߷e)S-zgUO^@sѺdbT_؝W, ֥O\ 69ӫ!rQ;h]2q:}ʥܺ2OQ) 4K3=$sW3X}y29+=_Wh]Reƿe&"8T׈ä Kla87GӮ^usg.@ .%[ŹO9ʭJa37>:r?Sb4KIS"n;ݦy;&Ts{OهGe\[..;_1v[l{aܣ㴬ek9r81Bd[[ضØPFm={A-[߲EJq- u[cOCZg1'S;m<譏Zdֱ ]m?0y)8[gv#!EN3m揥)זB0E|۩SDZلڅ1/ƫ5nfS֩fkw۝8Jɲ.m6b8540-6._hEwb-QbZjU} *B>DjBMkm>$wP }KR5Z-QK!?j{;7w]v73|YXbEI :=tsw 1,;5E@ ZKKX(+몆rqX1@.-lM]XScn%W":o\P?#l;PH#RۉjXwn9̢|Jn.VȩQXDuڒVUWv Վh)rPHeI,чv:f(/\Į.V(XGn/gaie>,:[Ahc+f:1nx0vlQ@@[+[Eb]w|1Ы&,ڕX6IY M̏ÖsȜf*F]9p¾ϦԀ36+ 9j*_YgZuu~G{998X ź]cJ6i󺩒Wr.$0Oݍ߆62~d F5=!ˮORBiБ8:b Í \ MVhx(f]t1%eEnƜ.w&ꍛ/'[p\.˔D9f3پ,΂2rl,HƲf)r*!XWLuNT--3:ݤpyR̺)X\j[JpqyRlyNI\*x¨} u=@Zİ+!*y(y9fjt4KWmOlx9dGrbΙT(6lqQHZ߲)r"Ŧᔀtv dD ` }9Jw2ɺf(ByIuӻ1%X% l@ib֙VˍEaSIlmv$ߏ]0}̞ $Pg:UyEPNF:]j.L]2 #ltPOl9qNnR/J??sz#[oZ/X(fq&bN.zgbm**;-ELm ad {5 `WXXהB^ʖp΍k/Bӎ8,&Bؚ|ܸcLj|B߯) ݯ߷d U/NLN\<',ɉ+t(Fϳ mpŬFak,,ޒmW3}s1h鴷%htȄYy՝;ܑz=՞J.BCЌTqX(s8k$Q Ql ̹|MZ(h'  endstream endobj 36 0 obj <>stream HW PU"h%u 4D!dl0 F3i%'nqim1qƭLv*"* &AET޽?x ]wο|Ϙ+4wrmUg\_ j0CkNr+rjTm0Q/L:h"QʒEjnGۘBCpQ-lin#75GwqE;"F@_dnE;oV .v~< γ|q՟;vK]O? F|EϭKQu* ߎ.?\!JMnCX\DE@ y6W sFL:'6+Pו.9yBԜ:/슗uxdݒ;G$WT_{ `a mc<ӊnb1caGQ'b%z'-6  ܮZN%_pO5` IeqL@raLjźf#҄lp<]'U9Ωڢ@ŌC]Heur(uZ:g2o5Y53cYSVȸskg| [&<Cx74W=,} d/3ʒwӠ4Pd6~wA=osIXq,'V۳*c[eG<|먶bpjV츙ǔ^ xGmNRb]nq# {#"\x-d={'٘l'Xޤp96u4]#"7:yuĿL#xEٮ2 @AVݝE ([Nr(qB;GF߬bߒI5]uLvRizZ,zivY~D̩*cS8-+LVk>BSxѹ_2bBn/G }] qa LBqX'/QylX;dǺ$7vy.QN&iXcj)q*0t4F/]ȤH_J9֭i2XWa *v2ͬ/c>Sy|m \A*R+5BC|e_;@E&OiD'}8juO>v4C55I(=F-Jgek: Ȗ%}]L= =e?B h#Y :fs|Q:'Hqb_vTRx{Y_fi Vk. :B {룽=7fqg`" B9>.ӏ ltu/-qGzïL%6k5b=L뢨͸uR`:i<)Ӿs T3Ө:Q^)r$^P1 Q缭:gVqO <ݟZt9 x!0X뷵P]:S[넬+<B28NJhw:Nb~'bxL.,Qݎ?Ue%]E#y$1:=yYrfuw 1m:2Jh☎m05355RbcSQ]V *}EH~6w2R25{į⤌/qa4VeNۗ\oI達̈S MN&kp䛴ja@$kHM%Q&׾.x١$䈾ο\<~l .3{Ye&I  c%%KE |;<z$95=MUh6챆V{uoDD7OS PάӘG4q5?PPjȌjV^Sǫu`ev( :!2"rtw z!t1?̡GIQ?&( D_:|b!7lO"}z#}ϣG8+]0^tz>T"=Pֳ-(޶@<3ds3le{ n֗SՁZcwp /21u/<:? P WqqJfb c.:|F^]ҥHB ڇCK܏}CȰJB4C/#orj:V/j# l!_|Zu[b;R@uXt7 phJ{3eI.B.Y#Z"EͰRnMg^*C)W[M$Ib#V6^V іM A*vT(nhm3 ZFRY:Ԛ);&"z]_{}_9qs|7Vݓ{{c\y}3G=|v>Ü kv$W'y24ckO5u:$(1vڽP^^P?ԍ4ME3>/wxDΥ 8Cr1==|<,dV"]׋箚(.[ii򇠔-9vn>UhAWQds^$Ϙl (=JD~tTߤyCY"p-aT>;}u,ѭҥ (bYF9\Ͱ|Hb䎵c3SS>лWC32s,$G(<(lֹ\?*Y>;899L@u*d~ZoRY7/tǚן ;R J4Vsz9(.vYK pLyO,3B xͤ#Qz"{p`TȴېZo^A2b:g"603 ^}M#!u0({!֝YQWϺ7ύ}[i 6+U5+lA|s!"q1^lmg]Ieɼu=lXa3>A׼TQ^]gm _v5 ׵*Nީ32"PuB$#k]w^T4դ|#vB:ɥHRYg9 i%zKtDB(Wu_x~ $OM&j}E{mໜ+ZD+Ւ/1T_UFc(y-ĐQW ~_$Ch־N-fñk OOHe'M澕ajPcs(F vZ=-tl5>!v@vy>M_:u]k˖,N_0וF=H2 C+-K>),9)))9?@[XuxucZI<7?l$L)II"DOhhJZI錯 \>w]fW%AЏw޻W:hPi= ,Y(FE]d>|m-C2fQYzV~%+Iqꐭv4}I%K޶*x>z DK E$Rg&+=fX|}_P,RJ(QIذκ컦W I*Zlo k1kK' n%v2r=1FpUTDg>@L- P&l:}WVR84b@=V<٬֞uH^tAƭs8 ̲P =^YL{&ၷ-uyD?iq6ݽԺ:y zUi֙GfO*DGC!-fsP#}h2.-XE qPD=몰z77@8[1.-#6Ia8o-<*,VN|)6o~XRW$zmb V\ttOS*Y'(j'T!5/Tלy_+հ*u@D݅u"aTH:^ EY$z7f=cR݀uFTSTuT>Q "&(EeWjk QZE3p?Jul`jDy]N3–u$N5"fYI*[NJtN[Za;߉ɬ*uR( Ar$",xUź6$ףrn:|!h4gϿuJ}A;Oj]TwG*"RGS*9QuS)6y\Ȭ^] #Jv7"J}+u*+-3-]Ѻŝ~]!s w .RG1vse uz aX'NO ^X8ֱ\(,.upJ*VBN5凷[/T(Ywʼn@ fc"'R,ºeؽ<_jcEF{Bt\νHTּ ^38-VJuOj++3sM LJ2Yցi>)|O~~ٍ}9?E.hĂ.v9' D Eb?evu6q!u4S ֩r=u*hX T똳ꐧ-봬Juux?g{ȫ7Z_|&JDz*J֏e"{PaQpƍV=ej%?T ojq#淲:t8["*@AT6+(%zGP?b>A __u݆f(l%]uz)|%u iޭVƺNf3[]fwk,&׻:sJIvF!Yg SX^u|\VbR U;^Ϳu*ze5N֥}P<ʂEXw?L:?SH8NG7C!lľYYwPb9>ck2^y^zyұ +D(s6)d4X-mՀv}%Ͼd{^yYgLvvV~aUp镎2AD}x:;g 9K0h`[v=Cp`Vs<n*2 w0չ *$NEz>o>lM`)v BŖk ǣ*m( 3@5qhsr#i5Z+~bLV >i6 ?>=, yfmK<ׇڸI JROAjuۮ#dԖrj¼s < єl9}H1iuɼR}k^cd(Zg/ਪ3BĐw<NmK ZɃ$ՙT3ڱ j!UUKG*t)NQy~9n{f_={^Ɔ_{:r-z`[] V>~ jmחUA%֤SZУ@rVwO1B Ƭum~s!>y=㸳Hє]Cb󴖧8E]ج?_ RFѝ}T]j]kI Wu-waw VFkYs <=A-gv~t_4] to?cOЗF?a6B*k3 MmHqJ=Wt{sVP/zۨ=þ*}7 8Zwr]'.`@Q^7sWY0%46T<@c9[9CVS^do>+':s}̞'c=^QxTtsXAѐŮC!ڴ=^vB[8rpOTܷ )ꑵVښ OGfVW_#=/X m wlĺo]`W0رUƆ`c/[X3";oy{ؓBp(~]D,R5_]WS漒69;GԎ٨~c7qvvF _])[bX5~\o'ί}fE sKFNEO|B7;nԯQ%=CVӐW}ŏU׎zz{ėy.O*3꣈z}csŮf9^PكsםozGjͨ>1VlX]B,] p܈h->>LD47Ӭ-͍MSR90Қ49瘔6 ]g2g;Nʃ+24xvX|N `&M[Stviҏ{S*jʘAᇭp! $d&$΅ >6,'wfbOjN`)`Z0dD;eA$~^05N/cI8w6Mg;n'®bWVVZ^VV^VBӑJ*t>r C(ҳ-MnR|*%+E)sL;Ů}[+C>h$ ! B;5QZ lbpD`a:Vw̤~T&8FnrzN;qӎ} ctm)ߣ~#G==fS&$3h;3xk[NГnӗB#~D,d|2ĠHIq琊_j[;SKFv>a(}"AD+E5d섾׼sXjj`esW}!V .-Fy!P{^NtsLc2G#Pg~Lw`?P®H5z\7uK*cm?m* O)Mqi8cp+̘֪$z+:O4aO'%#|:˄v'zr\dv1( YR9 zv] hQUON$.7qc;-ȡX.?ypa@"+B`Ǯv-:" TRfl]PG=JJ1[0ɽӵf'ungڦ4%[oJz-:OԮc! c;~ HNH8UJ ] :Nj祹Z[R7U*KTs6I!>50Kv7&+aetTa, /Sb.!c˜uc] 1DY^G1xyۀFN[n*R]>SPSj] :JumV)Hvn+0Q*V}[Mrn۳gm]:Ju08QG^|M򏁔:0,+wJ~uc]qH_k(uj+,_yͤCwj ىֱ<]0Y @>@9|b"BGݛ캫vd%:/${"ꦈv15u)4vd%Lz}J 0ezZD*Ny-[1nVKK-CJ7n[hi#Z,̤N5]0.AqQQ %}USNaQq 'JDA!R,]\T\'¢$).*H8*4%:FuPwѨ7b1mG{.`hĖubmYʶvҨqLBav]&oĞ@vewJUe夎òb[8V)gR^O#av]ډ+ !oD7tCBTVFL5ťZEx*vs u gaYN VܡlskgSPK{W:kLj`1L6®K;?/5_F 93ELFMEՒZ0@bckj)N j1iwWZFHӂ iZZ(D%V),p][Uvw{gvgؗ;svgۙ;w;d?ܭ"cߞ hPh](⇷Ƚr57\5M61:5s`wOBu@UuɁ5o8yK<]Y2E_3$vߴ.ZT%Z\e..޻:i(th] J.4Zu;v5zsM7Һ hPh]tRKxuxT|aܫνQ:ҍ=RF뜶`GDh,K_>a7;E3VI<בS'Wft_6.uQaϞVY:֘ {~;u>5ӘK.71E*Akߤkdz4qǍ =4M44.Φrߌ55U  )zE)ܺW/y9P1C?"}d W.u]X&&e.),$m9JѺ lSXɹ'EPA1@h]x(wb6rj'BBHEZ$E{Ԭו[w=y@uE:_IDZ(?|.i];i*Z[?hbuS7eM|nحur 5 %XHk2J?WFD% ZMZ9uV5;u32؉[3j nI{\UWLsミ<{Ph]p78o^F\u<jђ("u;Zڛ% if^F|ulPu~h!Rڕ1: mTƔ?"]sĭj m)LuqytkD ].4ߺBrP)uݭ֚8_7[ιĩwZZZ֙wjsԞW."u"Zb1EW70@h]hrԝ_62i"un|nN(㖚~6'օ&ں츻utnlKC}rPh]p"k`iO_|l[b2EBȵx?ӑN:׮Ț」/;H OFќlXeebsv@к$'=4{^Ys՟;3Tj>KMmڹkvPnHH}  I8{%@e:@uZGj:ZuLw: `u@X2: 0ZM$=:Ya֧Wu@ߤb?tϚ _Nt7tv=s\DJHJIQhN~J[H6Zز裈b֧؝G"I*9]$gِ%mi뒵ɗ,*44vQ[fxh]L?Z}u@ q։F)uG I1)u@)9],m]FuDqstVzpwHi|: (mu쒤_j_\Qz_w2gM\uPƔ z~žܩSی9omw뢜OfF{]lo1iyU:ax+ \e{GfAdu^`Qr]o[fOؤu:7ҕ'mJJ.;&[1f+|C0R٩h:uߘ- '#"NFn~.M泷Dsi4]moT?sWatx躊֑]6)?֕l37v1X-;Z\A?'=-6nԯh8#.(S~rP¶3d}뢒i^fϞ$Y8uhݎ:\Ƈx*?c)&kVRaxp49!Ǟ>jplƧ.?e\w3w>uH~GQqyw `TFtFaRf(2t E%c;0b;tu-dK1iA|$ZlqZ\ʇbApPmB|>oݽ.|\vڽ?]*6 33:vcP6ͻ.PPuBCIF?ҋ;U3, UJ-sz_/5.? D6sSmO],4,5v]]’Ur_ \ш. dD}.RF3,0HhVqo%ybw^Ţ݈z:4$Rn3 3Ʊ`Rj>:Č/T@uBkک=Ɩg͓:eY;RH,֠":f9 7Zq}oĹ7Pc;a8̌D0:!L2AjyqXe)Ovk6NY ĊB^7p&?CAGҐN' 1 YuB̘dK;'?WWe{ w'^䃈v`u FnllZ\R <jܺ)x ZSHVTppT5576.y=Ԙfn }s/W:!īW|y٢QMXu- C "H$R0_IW)(P,ɋ?D ̸AM!}q<^x'( i8HZkk"WC Pe#jqy;U8\wO^'*Rpzq NG\gt:Bb~[Hğ"ĺ09lu&ѷr(Ĺ`A0)Pl=>G'%P`A9(gw>?u@y:N2g0#Dݶ"fM:M,g [^n!%V+Y]'i!BP ~ ۸mzk=غ]=Rj5Iq^9iO$m]6y#7ZX.nQ ,:!:, 5 v4=3=G(ОRϲshvES\7wq铵_SiU|]>߂ tqwMvԔfԺ~΋g>sY{Sr/@Jnՠ<і >3irhui'-f֔A*uBv#EF/yL;\۱^@0о8hghs ys]mlō,ߥg !|iSq~ئgKa`>>JX9wGUWhFULU.D<'=Ns)Xg~B\ gX̚żKzmx؟)5,EPЧ !Nf}Ĝ¿1hg|Xn,Ź.ŵP .Pg#Wu7] X\,-Nzq"u.H+u/aUWw=V_Jy 47攊IoE/ਪ+PHXZ-B#haCôZbg[(PK1 j2e83TK @ ~LB}ܞs{o߾n޾]fI6?='y Lh=!/6 *<1b] k]BΛ,[9oPz0L&+-O _tߧ gK+ɫI s0 #A6zXw) 'بw)¿4>z*uL%f|)fskpvӧ)6l[\>:0e*TUa.oS7`^^Rn\/ESsBJr {GycR倣sm} wR:L ~"3Uec4}f%a kmJPO:O|څH* +sMh9]b`'_俲}Cxb} ~{ ;# [.n)*FC'PByUck>*ZpVy1R%~Q;B;]MJhtҔl?ޡW8%a\{FDVSɛLqo Ing叔1Me9`E ߳]O '5F&=ȸCVN*w'cPɌhWzA:LH9CQ?꬚Bfa‰0" 39a7K{,OtUuջdg~{M)qxEa>*)++e_iuw%a%c&B}AH3?} /*nwPL@v龚 9Kd٬Y獘~Oa.?^ѻ6uC_{ R+6٫XXQʄS9rpt訙j(dËS"C N찟#U&eu|2Rj)AM9T8ɓ'ZɁvG0_Xq729{t_<1ט&kjOe͝NlӴ2Ba PR Ǔx&~ Vn 8+E&3DgHlbWOʚs9`^OL׼ECE;:;nB0.lߘjA\Ho 2~D5`;Ui7˕E=S:PvU(7fU ,q@ $Pk"̩0؝`K."_-˖u^?ӫig,L>ۇ0zE;F8'nbB뚵fe` Ny۫9/&y$e8lgl|۲ۨpXG֍9D04,j-݀補ܩNqԸmIoƪrdQUa.TixdL=: RdZq<͸NYr )gllz&6U1~o[׍9JUj+>06G 3LV⎘+ȄY/ވ>`fK$f۳N9AjT 9^ Z56th ǎƅ(d] CP @ g_¹Js=g:tint%0(bˎpoi~(+eUO7P^-80 qe4nY 7{DR:s3Itr*\8JHC%Nq"K X{!IubK} A%+.ڥ9ksPZYya1zy7:)ʩ'R2A%@u)eGpgSI2~bv*2YX.Tf115iMM8%q;!k8 ])M(lo$d}vO=|SȺPA%պ!}8ˬga}d|4m=@.C|$ F.iQ:6D%D:U] ).B}a*пWR °~gp ɘon@"ؗ-vmy4`4oF‡:+!s&BO֔@LD1RMGؔSSS. !ƗZsb*4La-KT)eUPU]`먐u PD)W={4B!T*kI+q-Pk@{eK 5%.T5BiK溺 G D7B :VSWfBRAվys֋N!XcͶʿ&ء&0:AMNkA8_vGҋWB^GĶբm]ZXq1o@ FK uu[< 0W,n SŊrI.hTW N;j6~΂HVM l۲G3խ u5,^Om:@ܰi)P Y*˴6؏sn LE8gp^uG+{֝C԰yb1ͭ0I`[azۭ_W ȠǎS~;PuUԞ'Eqdc_QWnɆHH `B<ِ%A%<<$l*G@ӊb%s@"!D(`h(@6$;6Omٻ0wܙ01l" L򞫱--kUH||R4(2%1HβN$'l}B:P_jIљ[c1>xǺRW[}'m=ɻt\G>v+we26qxNOs-it]q-U/re{EJ;}K{ )I qC[]pbc:<+aCD&yALgYd˰C8[y_bƻOG~H3k$u\ﻱ}֟h]zq"XǺ`pnI@̩Thk֑AC?`"(ՙ6+H=|X17~#*;4xj;]IoW(nH+h7G/0s:v#Ngܽ<$gR U1x6-5#0V5:=!ҝ;n Fk)gJpX}'RD}w7xM5'."o]a0>/Q]pr:S3{/6t[桂"g̩3#@Gİ !:R3;#D;ow[O. Ju|ki<(y֊6 0Y|{&9b>,N8.ӵUA-Zy9K̎i E|aVMk)'-};ZZ.:oZ<~֒p^L5:G$:05cXufR6.ösϩ:e:Ȇ䧘Ds4ZRnvݿ h~z/kR0Rߖop%OY6"Sm޴D/S,bTh3^Aw_' b;䜚k_+_%)7u$u[X$&`^Sȥf<;ndn^ ş[cgOaݠZNnwb]MΜ;j0l:DN%!rWM2l|H2E<,ק1O}4u3$Zu*ڊuW5sՔBqlNuXfHlrd2NQ{7W&X MGNw=%?dA#KzO_ӆQ)k3@W]:%AfTmi1"On.6q§ߞ%uWL6Ф '6hN9i5tۮC4'Ms[#`hn^@*rT:jz9j|CfГ)hFG wyMX$i}YB6:EZ;g5Z-ńP\7Iγ1si:>'l'_4j?>`GN\6NB[>lSQ?eSikS)PIv Qwr'^tģ"Rl: :`iw$)KcӫTX$ҫnjY +&ae ~bb/mcM$#z9*zG6`~ߧ|kuLa1]SDS Sr`XWO#4F/Qi:HZ՟Z~[0#`^O2W^uEBЈؘȡq ZC2"cQO9VG)$,6jEF ,ˇbQG\ #rE|lv{HX #&\+9^ǍyͰApa!":8uX[QcSGm$gnnBzs `]@ p/VBMk aUi&ƺihR,xxN NJzSc]6(F UZM"Zx<55G*{@ֵerVݬi~wU\q/"y !< RBit`@-RQF[-Z+BC[j@ ë"L%MH+{ߴФ<ݻg׶HX֤>kd]++GS(_a^k"jwQߕ(1 Wb5w#21ڵ[9Q^i.n˥U7 HLcN 3Ft |zGPP넧2'gY.{%_򟛒hK93gzaIqb@B/J?aކV1J1zrzrYǗ`.S4-ta 7f&ǼߔCD eJw +l%B3`Va< -#D__)DXXכTOo@^:7 VoAVB#"CJUx'):!-`]`5d4g>r&>OγH<0sEȦ%:B%%ﰰyӜ7h5Vb扨yGt~zY 6O`ckP%׭?D.-`NXuZ_nlռS(_ju؄GnvpY.3 q^湱ƌ)JZ#āxjloUuX1q% )Fd;݅sƪA4_t@B N NXgTFG0o}c:mEvmT}2GGNu,`]`5cGqFKHv!n9-*jqfv&HQ%e.iI"y0֠>D>|>lY'Ee]4@I)Bz<; 7;=ĔOkos;AT(%)1{5Ty{[g2Lu;gpYgxz /VfPhmhTH{y) %`9 ZKac7&@a4Pg :5o3WTu <¦hJ t]L XX~6$\6ƬQt?7% Ϫ:1}D\L $vD7P6{/k>si4:,ñi\ 줣Z*h=LaAzG2s6Mk2P+%l}uE-e8k}Ln{)zd gZjwUԖ!J?w5$)%SUNr+ko8i3BQ뀭[XN] I:;t4z|KX@ P: YenQ?뜀u-`]`5gvp?*~&N@'B!zب=`ouS2</j'ds?STFNֺ T%yZ`]Οi"jSx>'rq2j<3g/6yZ@Ԙ SJ Y~M68Q>:^5}5?hMoF:TtY`< ?G՞dBj C8ݰ=ɟtl%_vjH=ܨȨ_ j$[D|ž53xq!jY QFW l]u3P)U8?ϸ. L{A.L j%ᆔ+ 뚟d5BCO}U_I$)D;d JNԉ1׋NBl7UN7|9w='` V&®#Î&vԩ\R9%c2ShQ(-nM!cmGW of$EŹk=@3-J09?ӑP21j'ϻizJllҞX=wl.!v iSyЗ%]CqZ5dH7QH @!LgRd3e顃Gߧ96:azQGرG^MڍĄX7Եm`zG;X_]휅ǎ6a +ș}tuP*)J[k9 J;YG4BTB9wهH]mB_S~aO*=+#S!o6ElP'MQZ4>uۻ=[ QU= MZE]/IOs_`K}7MW6ݳd{/13n[1X}\Rzֵ:a`_2+hkc.cwecڼ]:)wsǙ{{"/t#NQ7yKYQ8W722iVRSc邽rJXrh<8' ̻Ņuk:!+'{‹]ƻȭ)YFz [4LX"zOzL\`&GѥFe.ǟ)qCn ~mKYuu&PU]Vp;:~⬋pol/"o@uyyG19;/v\-a4 .+gfgg+kYteuzq/7BN54mʜQ3UJm{6rNNVs9NqMrS%J*SU[+:PRӳ'ߠyYZYS]USS~kgޥ)yJ+@u>E ':9_˜@%R'RSRNuJ1 T<Q;t>@G֭X딢:;Ʀ5 =aº O %|~.OOέS|'0디bR]Vhس7a<)>'d‹yHf'46Vt n:%hX}Bc XjQH v^;5-Bx%wY|3oZ䳋MgoDuv)))E#:hGoL}Ϥv Lr9 *(rk)_ب"%디bR%cOUIoo5ZZ[ Z hno|} O0fhiiMt/eY߳IH ŪVkmBI+B#ZT8q#Zu|"ёL@:bB[HkF;(@bm$yϳw{۽}<\ 8%!PQi7(KM<5C4;S`f̮4$p!@~՘nxXRCruƕI,CMذq*>^8*IϮx{=Өf-+ʷcSZjkTz,sմ??fTދxpሠ: oD%+@Is4:˪:+#}^ x%&w>0!S,pሠ@~SFbdK$^2Yݗt :.e|n.T =>w|Iu pDu =F곏8]|J"Vj.G16Kme%llڳh(7q6` 7G4]W|+YtP{ն*}` uTҗ4Fv6u QmTBC/OƦ9r G]=Ƀj]+.d2w c::^Pw|Zp>O2Hԝ2ewEЫ,M\r ^2dcUwoQ)juvՊw@B0H dN]gy_ D Y.R˲QI *̲!ƔJ^9#.@/ȿ5ߚKpQ=c\wzǴtenr .*^23Fʎr1B: APu5 dӈҟ`g+3?TIt0\iDuR⋗+%\ݥ$J'(3e{ӅtԮ7K9# z6/ \${JMCZHΞA<׽QF;xmSqzO\x]k9 ev!&X1R2w]+)u#Xv^3rRW!pa~_r *3nF/Jyq+ݏ%(خ;~X{":arh9գ2~0Drf3{׿1HWQqr]DU&;ӓ~gTieuJ ooJ/E. ׁ49TQ+ WnܫG3.@aׁ4?YhwL'hhO6pHCj7[y;Wm>#d9Jouf7G&uuTdѡB2U .v8jSi;Ё@MMsL=GF  \9Q 94V^DP ,pNbU>a+MISobIu;ׁ!_'|ws7sBCwa55| Pu b(x{μ:[:MJ};z )ar\7yW':~1id<\C)elm]zmK]iRKrRNk3<r)~Y9/JuHJ ?'03,$3/nnל%®qs&/ktD9\am$Nz&y<1X^O6 <ஆ$܃&j;R,5n^FOggk/$8F7J95eAr7&@C}m}`ƪмŦ"WK w 7uzb;O6iph%şM]bLE,-Zs[֠/\ɶ;dy_-]wV!>FN:[Rx[ʈM I멗Q[*^ųq:k%:Ň r}:tqo:\!/iuoȓy@'/L_R^l7k~ 1L[̨hOd9Ffo̙[MMb3ݮiU[1Sb:2yKҵ11إMx"Ibu%U%} ai3cIy~[Le]nom5مmlKف8`q֙B#Zr)X瘶Ny:ʽ8J+e?8wn>_w/YYE4>f:gT|uw X:V&Jq>sX{ DT TZm v,wVz6m5R)2/{b珔gzU靷;)(3|iS/@bu*m2%%m V%V9S^Am>8 [=[0Y:6) 3r҅k܄5X8ѱy S:1u}O#Y~efKmץ;$ƏoW Kyy7hfe.\ t]2w2c:~ʞjuy;cRuJJNҝn&mwz+}6/-3G~Cg̤&0w* tΔi ~Guq/O 9Kq,?" fThu(-u:j2i Ԗi)*S-LQK-@EqTJ$R]^.rυ;}i^v>T6W JQvEP.}Vh blC..~9GOw:CdYz4oխ `SjE c,6,BNkEh|Y'/0،Hm6R&.RXT@iZ (P=:]T6nYO.P։1H7pϟ;ν>@pydjZK*#uObO s ʄ|5ZHj9O|d$pzږs[ޕn_uKoP^Y3H֭k&v4ҀϿvrqs45jc]4*,yuw;w{W-;g[{=GN]_X< 9R)46"H]?kk܌3^7jbHm09Z;o`7>1/Ej#uwMfd̻#tG'r3sg H(Sya]$wBLVY&'Q̤peńa0!E2v[UEO 4 5Va0ӦNzxLqpJ4[UXk elI80bUؾD+a(M8KJ}ߘ[U.P 8?X9 ];&DB{3H#kVX Ba拮|k CюnYvK.]tmhЍΠV MGݧ2sfNovG=kC@'OK? S2bܴ2 5V=B圶`BtDInȟZQH( ~;`aVxB7^v%Pzb>Fu h-xc[F r0ǾK"i~SꗦYϸNiÚ:9RބKsrZwpQחYX<5->?12CԱgKmun 4 - &˄PS#v0xz9c,o~D֩Etڝ:z}=ZVE@"aA3X}WOdL=r{û v*(}=#(NOƹס)`]X@>CTj%l"DT| >   :O_M )>޵4 &8}C*Qz "8M;싮qbHv^t#Is}6I+~Ig(,IbLE%g  +4;M62!/!{'O.]8%פ}+~HȎfC@T`) 3&@ё}(QCQa: } `[a$PP*8*@Ƕ(vDy B9Ϲ>b2L6sb!G lÆx!餌%!O& 17>ԓZ!@?3ʼnEIGxdoлukzi[/Sbabvx14d;QQi fD;Uٟrs҉u-q)#Q$CT ^MB9|i[!^ץo LL$6;TIUARݼ"RU__-3M(?ߙf6vMl8?*0羓-nHmRU/v>Z:.c:Yd qkeLV='-4=l~uD&{q\,Sd:´-g"Y"u+g5ÕJD^4}D7 )C#+^ _$4vh) ?5+r1SI:.ȼ!BHۄDi2}!q)zRlZi4ey~s)';WS9 uМv|DX<7lBִ*{/ a!n=^8ƛI7W<.ۚݚtljQ$)V~AreaY_y珠+9 s<4satNgiC֡Kgs?`ԉ3S(ǟhVONy/.u$?uOIv49<>՘ƕqa  xsei/2,;F18J 4N~7'k>@ĸIkUu+16⥕kg v'{Yd"G v!ga0q=]4&:UŘ{O/O%>& K!ow"n"Ȧk&[5h"`]Y Ji M"g2*S(0qhCZiL6,uX(qIn}3 &BbBs:adn^fU[S6dC&/s*urFl඿, 0_ WK;d6D;_=n▎u)z{B\>ȦP(~ S|(n煸g+\ +yڃp<.p+_p -kq V]q} ; )_t\1 RX]'^}[зMY)њFW(w1tlHjis,QbwlR{߽͟S9&mXPLC[U'hE L&KE0_\I$a|ݛB"HAj0%n1}$Cu0H꼴{@O\2ol9aҝwy3ǩa[G F*rDl`=_ X}nty7-~Be7su}8E^WQZz./:o|QhCh(e,4AGgX߇{K')v޳:*pCcv%{#aޅJ fJ+҉uKAБg@6p)E|f!͙8`V_irɚtbgaf1oQB߭El-)8aGήPX ^BlXREBi͊6Ӈ?Op,x}qq|T@gZT 4M @s֫ݼ{Lyyd(nLL)1,{y]N3$uWȇ@\ `j7W/] XpNy'm"(^WcVP :kbb$ Z6wx]z*SS~z^{̖h6L@k8p۾CVZ(sܿJIC 0i}x6 ~}~ ѥ}}B*R{׫҉uʼn\{ˎ ]i` _aQIހ]ŨxF#*rx|m55ML&n x03@`EAAEE~sh }KzU"7bS%N28=*UP-Ss\Q:B90V7cCRA97sF|D(&.8m[UNXd_/y{٣1,es$}ϫ2,Qk@A'  vU\l⌈&+Ō`%e>ɋ z׍ߓEb׽nG]6>3R?t:F鴺"Ύ>Drw#?͌%wq$QM[Z^yւu"r7-|bgcz-ꋾxQAǗAZB¢h򑛗O3gu@$6udY6;2]>Kѯ[ݽ+5e!^̞+M My?woEsM2:B<n E4٨ft1&$U\)d .R!s6MzCey7_+PX'ٌ}}eYuUT|u=Qi=)\J2TQ3 >OPSf7DXalh!/Q˯ƟQSE䉝ġU=񛍢Na}z8"3Vja13Zm"Tº/Do̕qvܽ/Mm|wh{moZJ,xM>hQR#;׻(ux(q,eN>5m^REoc:w#[u=Fu-㿋9/#&D"drB׻DƖW v9/M6y}"A)C|u3Ō8 7N4wᕝ@;Q) V3]lJ8Qwvϱ6rt_`㬬Nqt"5{j`D_LM==OE'ROΏu9S=Ңԓ-=2 bG;t zaRr '-OsZz"m3٨]2ҿR/OW&"_:wPf\V,@2_p H*7R-[w` [ۮ؛P?`P~6~?tS 5>PjDsNdA$r r|՚/ ozt {piFY4ZrSlNJ`qJN% "^?449/nwXټں$wpKK@י7 q)zh^ Y{2}Zn.ߥ/qh~(&v?FMf[8ԻeUDB 9=-1w$i7FC2Ty*F皒 /҄"=CLP,T\UIV.T?OXo@QpX2-2 Z1xnVNYiN1 N}]rg\57ᆥ6,ip︾I&kE5l*s+o џט8_{R} X C'S/fXȒ1@͐&Ìu/ d@YK(`<2hS^-,TV!Q`݌G$3uyu%'=p'ՌjH9/RkEG29mpUW{U6ɩ JbOnW^Zie~CD u0NKȪDVihRc{>pGw D.bmzYܴJ==FVJ#5y)^TD_GtD/~qB{ ::LvrW̳X$}EAd,*s$f*5"ny`鐆`; MH(HGH!`b(P:PW$$`P + j-4@A2!-$oŲտ0։}N~T=Dc|$Foop'? 00r_Y:%e~}+L!DiUnANzBKWv#+cxCb}݃8óSk{B!V[*O ֔xޒs,ߓN5zu>zJW:KtBCQ7Kq].0yDk9i%#hѳ1y,3T.Pt낂TВd.!gJ>k X}ݼ0E;TB[%X[h$nD|Ww"ףW3icm.DsZee݌uY^8U:OEpjI{WW߉5[^5Ŧj߄u\}m</hvm (ֻ Qa%>p(E>uB>!cɒEFt`WӼ.jPo+_csV>`[/`]썺`_~2/נ+}_ŊVؼ4m3jcD,ر6SqM5$Ll~0N55A*+@0g{/\ k^_oAK> :. D:uҗv F92::iNU:: OmE4Y~.됭J @)n{u |~3 dMI&vV0z]Yuδ) uRmDxsΐn/UA!DjgSGIωfnjiX&+^n0.VµúDu3ddfdd2sZթX*YP_}S.v1%KD[eub eXQbrj#}2TLetWVC}9u6P\$kf]HcJ%V9\֡bX);0ΔR; ZS%b>E)L]K,G9 O۠[]W >{݌ 뺅UhVd ?LUwg]&K'\]GufTDlPJuM*Rщ*J>&u]H.pR3I!8SBuI-&|kYdօ\י .xi6봻W>C[ɶep~wFnuf؈^Gme x9]$]/u+4UP72 [5BM|;Asvz{ʬk;8}DL>r5WPTK6rdw0ϺdXlvFgdf뷛.*x07Ni]vp%̺&zZͨF;;:N̬Y,1'$87 UdVh%yAND.xi.)qαދr%u$S'ݕC e2"Uc۴u(uX?a\nwO feut$:z&؂7V.t J_=X'[~x~zއZaO?Y vHo6wf0BUIǯZZeu4mcVYGE44hw,3 -cY:Ygbt^w5X{Jd:Qt!JGte>TL [5]¬kJ᭯yJ۵4uU.Hkj|?V7.X}MZ>FxkY4[%,Ir4GD;~Sc9@ക-" coiqAuyn :Nw򉒴 .m5m+qh0OX7!gDX~5af\+RkN:}.ؗ./GqڔN?_'j.1ggZ{]1uyWd_Oؐ y>!&۩(RKesI:h'kN9c{˾ey1Hh&,b {4 53cmWc f:9؍X Z4if,J)Xf=sʑm7rT:4-mF6ŢJۿ_:ugf]lq"ҤEI~T Ls"JJ9")"P{u%:nc0VzEjS2ӰV K'ak% "ۘ>G*yX&ۓTio@oLuVF|B4ۖD+T]>g׻l|XHA hҘS؀7FX`9ǃ\s GA>zX6XzVm`W܇"-=$osK9j?Ys&+_%z:*.̺&H>6MO:qG`YiϫpZ.[+`p XאCY4uf V?yh? 范y{?G@a=w9JRO!_!(K+z $#BIKKo`t@c_2 Fw5ZR.4yu 5QdըvϬu):r-2V8:ުcrwrtps͛f>A2n>$g:)hNlTpٯਪ3~P@yHK#UhNJUN*2d< E DZH&%P#G6;9޽ww /};a6?v>xx#Wu20D._C!JVy8;m:>UזY J,2lǬhTp3١/e4 1kRۄhfr0Qysy*KYsC gSu+s!T*/p%“}X@gyf!?&Dyf>*'rfDp@?GF, g5u\>7rO2OlB* ܟ~\b{Qю! rwPįpOu7-M<ba"Ck O"x'~wEuxgZjKX.cvlVVHmsW!{a&+I-F )@\.բ{cX!I^Q8ROJDoׂ4k8$D'=pڒjS=,Q|~+ȐYm= ȟ? > $&C+7?zq9?jP=yU#yZ#GEW&.(W{L֝PIW;%Id՝md`Ywd$6?^/< HR ))v̍dg]cɽ"ls'N*3Do"}>㼄qU\i Tb Y , E-Oe!klm"tA5o ӳi߯ 7"?&rJj@'֠J>̢ie߿[J&J*;!4#fs!|2WR4nG5~ݳНϕ@`2qWEodr-+۸.?|02,0mdn -wR_$)dZD&얖VZNJm݋'\waiIYeurݺ00cXpqT</_Mv9KxU" Fe?}rk=aN*FՄ> o@tJpPh|cl(A‘2Rp8^r 5m5z$/v-WQug4] !o+?#,[NސXUzY &qo0-HƗ9[pD,}ESr*J!+a\ 4 LFxѱa5jTrC,03¬G .R} Ɣ[,%,ul[;(󹦆En"VќxsOE(QmD-h4luo0V8gfNT6!ꪁ;5NSf角!b.H%iG) 5Z^jƈ~  &bg%%" |Zbϒ4 (AÖl1 YJH\CCPz2sDֿXXj֥)tE:QGh@jR-,LUYk~дة=h(ق$ dfFw<+7*@nN@:I7PGWU&6 <~ 1=}R3$M$֧J) #ΡȢ@;C*C rϦS[6K,m&$#Q$Ý&"flfQ29 R"k:jDF!b$udž]λ~.uʱfDzT" @ jpO2dKT^,3o HkrhtSkM1uA/_lIHRiFt0cfBguACi 8 #q:gY}7ű FL:b|*!:&D b@* YCͪ_(Ӎ3Yε1\l u/thI;d g92V0Pe G6h#.zW*:1n訾B9χHQynnK凹]xbˆgQFiKJ|#lԐ[:@-IvguwNE-0Zf.e^ `E3ugX' #:Eau(/LQ?YmJГ4V?,VU1bk-|8 ic\ z8fDk; ] Ý*x_{i})Lu;uwt뤼|j# _>:F "'xq+1yiF#e 7ץÔ;Ns5@8VA!z~nuS@D,R,r:~/ǚ!ݿgw< e؆`\ Tk;/)vۏ*\Q/Q̞ Sr_&tyN%y]EŜ71^,~Q xfTlUwN/\:B9Hʘ6_7y&tbWU (`w/ɥlAy+|/$tof%cMYhԐkǤML:as8O\:]Цb7BfZ%&_ԆnX!tIbail:8L>I׈`=*tJ,u(1܆z@Fyz2F$"ƛs٬NG\ C/K[I]}h!尤?%kf3 IT@BO~]mÝz`~w"ܿF7K^ݠXTѳO2:YRCQ1% e`0xu{u9S5sc7Qq>uDsKsKE"pOhs4JJz2ZttlW㹞\_P)# QeI'{~~]7d % &qx-?Tʽm·P.6ejxpkx/ Vmc3v MFOג ׇ6L;~IM`$ס2ӑ{, =NG,~}Fhv:%1jmsBWP(kC%:iduA`0NHtr˭\OkoVl$s}ڶ-Ju1),>@U!%uCtȥ$ur̕eV]ZȦP5 "DV:pm덨ޣ!*&qѵQK0{A$:!H*B:Hpc[f<T~.&mi8q _>tԈ*g`hq$>]dG u].oTv%UQ˘NH;״j}^MԫrƄjL]q$!v"ګ@XPlcߠjdWM]~-ƪQts~q4;wZ13$#|0 XuWd5UvE{ԕ_aP@Sjdl2`rL-r>'xvbm+ϫ˨J_ 4pA+`6a!%uCS6! E` ry6h!Tzu` g k vy= JxaR V-UE=1^CbԏĝI gmr3 t C:ױ(֍N|Y=7:o"ە.~{5lX}7)h`ou2`йNO[etT>A^_/C?xe߫d2C*4`0?κuSqeHs.j8JRQ1bI~e>l\&Y\ `IN1 _u0ξ`4ZՍد9ʼntQ@&ruݟ&PwAxe{8881''H,#)))%!%) s`ˣB2`R]ycP;M+k?1 L@H~(˰Q0 hQ0 C[,*|M/[Q?Hԝ$fϘ?0C7Z׍ b endstream endobj 37 0 obj <>stream HkTg=B ReQ+6Q XeIcMijZ ИKmR/vJMzkHi?xi e7xy=gݙr{ΜfgcV Wş/z+f2ۜH\眜s{j5Ƭ.}|H´O or 6+[Cc༪ﭑjXxH @ڦu-msW<=ExK+ːrޱ. m(P.u".qhz?zwP'M68ɂ=i[ v^`Fn:L(TnsTB`\s+q\zy;ͺ4> sgΤ,t;Tߚ=\XܕhmuO;.sYgQ/~͉ʦ}ZAU.uO̔кD "K8I:٥踰J2j֩[Yx˼ղ+غQ;(i]TdH_%Lm6Ĺ@9QԊ9.6.GWS^`m:-8%CG+Mv矲Zzaq[aʧmZWYih,l^k!rPZIcX'_pޛ=(; <h]NuiF|̬JgmCkg9L՞/7Շ<@ Ѻf=Ĺ#,\6՚7Ҙ<@IѺtަӖMrGn8Eh]DͻuȲԅff5ZE` 㟖qj~g;`EZV87キLpz݋f˟sPrY5PK"_޽߻q̻||(1Z$՚91qUWl8DFh]4N]rŊKC!taӸP^Yj#Mq[Gh]E{0?{ 4ʧ#fJֽeCUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUWiO J:[|JV4RuV*UBZxF:Sȍk+O Ժз8oV;-`+SN.'\hN\Il\hҴNNN) aLiZgj:\hҴNvsvN:OuއX]"U| oX8 O޺(ڡIb$W[utufjK$'݇/uKB(Jкls"?@%h]jׅs#qlK= ehWJ>9Zv'jȯ 39dzNmxi(C4M@ Ne#\Z3*uŹW[CN.2cW|Ҝ=t]o'lXr)uvs@S "n .dT*Cf[ 5 i[#5.e5Ȗ#(uro㈗.<^&Nu:&yZҡ.:ZhR+tZ_׵̲U'}M)M붚u1x':\wX8k.;52҉B-Pxb{ͧ+q01+G'+,/ב]iȧ ;(u!xC$" N}:Lr\C]ղEeM;j`5]#[/beV S]\$.V1*?O>ujË74<31{d;uHyϯ0on  Zvu==&ֻe2gmﺏS.W]u)~+6(8lV{1=ޒp{^L:X֙m YZ77 X_3% #]l^׽q$/CBЦ4yqrnS(nltPdox$:Dh N6^:YtL=/Wn ea ?5[~y-R'5O9{P:O+՚rncs?eu$`BU*PZ Fg;:KZJ[;E%3be'`PVk+KBB/H$9ݸĮ7~5..e,ZoxUeu_:o4ROWZוɚx½6nk..9oa۵/ rU)SUׄ _hD w/+$Dk[FĻ9v<{@SI]hdY*k A,jÚYd kBE^a: ErghHjGydYssb6n.5.~ݩϭJIYEtHYLW9VAj"WB4dG'a7=U-x*bbot1+Igp(Z[G5Ķ.*~8̎2Π[KL 3S-Uۯ=i3'9mTf 5CnCjjkb=yWS<7˼IZ'u&)ĕIekgS˃n3T(͎ևv0P؎*Ljօ=k`$Dt'ʚ8"[-A+KdwϱH_幮XKՄ r#EiL.uJ 5QW-yU*mwZ'k̿'?r5.aHE3nbdyLǥ<\zwcLw *)N}Şs~IuaQ֙0:K뼔WQKC>ĀLaH|uJus╭=ZPhGύrKȋhj7u_&z,5~iT^+֡^s(0y%taE#^4z^Ne\ Fh*쁺։*t/i \6u֙0:E뼟èw EXXؖ.'~P5'^~5!T_HzߕVfU\~kDs@qX넩uᏺM -h\8:U/g\E"WKn+ՎS;Ug>ҵ) s,gSUNöǒmu&^{@Dr?i 4o \a p/8;vv9fip#>}K'9`BŹ|] a"p%7NJe\ZTRVtRdw1k_vWjկ&ESܟu\U>2?soNv>Uf_2fih^N@U==(+23k)4#aOܗ}.v렒/ 3z|LfCQ^8-J˪aY־Oq =u&N b + &J3aۨQU\xKo = bEt{ر93[M.}b]YQlr} hPڿ2RleYHH h-*S#nGBLt2vr;LhԲCt?MiV°1cVKZ1^M~W{4eDI9R1o 0M~Eh~6O @[BZ `)Ƥacz ءVvN6JCE{5."fVG[fNxUpyR"$A =|bZg:Z밪 ID7;:#L=UZTHwJwAI{z<г+YOK>yuIgEj(=񆅢Hm!ZZž-daqW oujo6}jZltb>LB~wHDSPk ?ܹ5aDqU^Xw Q1[u(7AdsN}_~p^n#s~^yL먅?_@7d'.AÔVPb?S)g{D;(׌}bB.>İw7w :s֙:9BIyB sWhBmٳ`:.v֮p𳦯 {.K4,o)mǞxȸ9 e &xNj,(Á! Jm)֗$WQӧo(d[cKFL7՞/2*LEi4y=}p IRI؋0dϘF?羄LVBRq@p0 8bC-LBXTAZ0AD,IXi˦(V):RCTXYCޞs}o^$@K#~w9szMZeJ+2w@8|ẋӞxOP8s,]qm\^QQQ^YY`UonWiٗurׄ217FRԌZߡ+׼`4#( ^kpZk/zV+:W>auoGDJ=)H9t:wU#d֠9J!֑I ( YNva+< V縬y?2d]y؅窆}##`+oޣ,YjEݓ@hD+AqO2_!0!#i u T:Ua>f:e6ΐ6kf?AÊDOp b3Խ>gb*>*4]zv+fB|*ֵ 3Yg۬&ai-:_K;Ic҇u]vIn01FP]"0X'6(b2u`=qX}Y >4L,:IXVV;s, 4sՆrYC_n#]E\,apGΓnP|N>`D<ZlsG5[,kOνB>úva:P , 3]1yZbr?ETbzͫ뤚 pGa~A~YD2`@.LdA˺TQnn'8bubd;Am8=sߡOWac!UgPH%tLPĹ\Y&7ecȗ%J>^%*dj1:# }Psnj́]z$Giutc1j;o͡X8,lXd.VN2@DlU'|Đc=jkaL6뤢Zq$L\5f]: (17s3?1 [ܯT34AVF<unU!n9:4𵺃l3i]:{!_^"<^z!-Sz\f!Ğc~vXg棝SJɟi0pzP}Lʸ#}nIo9b c̎,.3ZEsGOUSV1e+Y'MNI d]źu{T5Q )f:.Xnt:A]) ?1]vlj %G:bN}Nuyr^fLFKץudȺ!M\ӷ}_ a: oB5D D̼RO&eVs"so:INK%&"ۏstݡlDOt.0ԗupwz]v`JIA\U* ;jލKaf - t"g:hGczU18 & 'hb?=7JAtЫۊ:Ex5OZסVsfal/us"h%Fc&(jdVL:cN1ѴN*5AaLjqLI, :sN{/#\޽ss*ucU pw'8+J1&G|Ŷ"x:EMO26.^)!]됑p~::]mRC1O`6IiMKϞG432rr]H/?" :zeo+ꗉi͚t?hpQ. #-^3WxƛrLKmuhu+y۬F`XF񕸁kP9UE1P[\}y,y*=Q _θMl σp) kx w]AjC^aWa't6IyCb ք8ʻ%auTDQ!j9뚸M[t}5C 1nr WZciHdBM̠dqEdֵI1z?WGX#چ6lcow9Yס6Uz@at %; 7z+h~h !q# pD%.uQn!f=pȞYc'$Ȅ0Xv\$+ D_G![K_G^|$Ș!bM;|0zզc&Q'GC GK](\Kp#L:'w9%$i ȦrNm_'_1gɘ̋*cuH `u.nQ!i.Y:Z6:։7S57tl͟ʼn8xخdٸYstsxzuP'R)q ,E?4-gnA(Ge.^+Caso؈=B\K_NI%tO &˺+O.| Rk1f HòYQa+72mj!KgaoOI`_1/ v]/$Z rJMuF_'>57C% fn𭲴QF ]vYOCU=njo.,=uX=oQ /;wT۪rSq[s?rU҄◄}`=DyLR|^:8Af _U]/؃/~Y2jлW'hH=0J̣&ֿEYDz~.NmK+\[OKD^AdMD柁8_7:v3v&zvktY\]%kUFiYיtOf$uhqb9+"EAo} %u]@3 Gב\ %à*ӭ2G2ds.'W̛`>%o'&D<2[*}~'_0m} .C.W&K`b_ Qv+W FQtę^Ҕmjv񯧢:a_l[rOk-͊v9,Y/O=HdrgL@xuPn 0]g&aXS & i+g:O0ЙFQY'7&N3#hߊgx'1HpSj5l#&B iBh2٣=/gDءԴ'V߰Is5P4LkuрT }a°[IfeYu(U-«>ERAT4p'!8tbJe 2دfC#}ʠk=!ڞWSKSU]ձAOn1a|m_wrƖ;Gagmut$ѣD$s98va1'U+I9!76-hOBR[3vRMG)jD1{x3ZBu -v!mٲt;|7~*F=8-rSR L^ .0rܤ>BC3Vjſ6(I(ٔZ 3 LSaA2 tx*(m80L#-n6s޼M޻3{nv'ߋkd^put- Kݝ亚Szy(>^1z#c ׅ雧\Z;jpo+Zfe0=gAޝRŮvm;}cȰk.V|VNc]6DY(:ͷΣiZ#yWh[#%iTFvplVJâClR;Me<ǎͻ7u bt1}ŵ{ 6֑J.+Jck$y.}WWG#6ut"KsNΑ]78Nsu1Ϊ-?&5v5+4|<8|rO}UOGcw6CcNetw; +g)pDLNX l4rтɴ肴mS9"mbioHC 1.lyZ bbuZy ыvguh[Ԋ0g' :]~6ʪ%2C,'? l3VuU \SױDkzwe$?E+Ā/TBjuNvl- `8^5꥽]'Fu\)|(vڤLwzځ b*G?P]oLga>iƿ T)@:>(fY׼M[u}{GgKָ:X\7j|KdֺJظ"h/Tv*@q"w]3XkU f^jkN{j41R5`ו# m+czu\\Y.n:}id.a晟f;y@Xud=R['kL&ӑh:.ȣS;/wϡAKWmͬ]Йi/yED:(N;RD}>1 J3g͜9k)d2QG5Sj#ڲ'ND\Owww{6nzwgGR̸#U.5#ALj 2r'r׍rs txg8ѻn4hCt^`*ʹ.Hn97Nva]DGr݄xPs>ߙfя'W1қjr.P b\!؝rz'+ P!*:m@II>nszdT;rDI\Y]PD]F@ND6@Tu>ß )$ٹ?ۓ31T5'£@>y.Q<{#/] bcP\?={ڌ^n \CCcNmK1A~YU~$Jְٌ) Jl@ Z %/4^4Ed84TSitu 0aEm@xQy~=o/ {=s]ק6~ @旿k#sHu+k>ٷC.k}2ɧ}>vmëR;@Ҝ>T.[^:纾x}m_)_THu9qA2Eѻ)NO'P!֝|p995&:KmJm \ˢԅP!֩$ҹw|UlVoP)uv' ucݪP?)1F:qOm{qSj5[O7?eu)J4[%wNDOsGW8\t?>oܹm_` &i0O&dYϾUIwl/ ?@=:-~)[s]Kk9gb纁 [.jݗ]A2iUUFu[呹;q_r_}DZZ7.QۙF9k=]=KlgZu s:XHh`Q{8Xѳ}NSᬌ/8Yީ+-Cojook9R3>6mO!ŊR)4>?w:zXxoߩQq)MHTT-mhj5=*iϙ[jve=$w(tJҧW9,uO@~?w|"PiLuͽ===Vv6fc9HpW4XU}`$V<|FNdyq@歷[7MАrM] 2yFոu'6um~w:%vٜsաOx%2kuQyE>qnvJ0 j] `i։X_Ynu̬u 19'_S]ڧT ZuX霋&}65rh`_u`0Tyo:d'6:@Fc.wqigT=Zub3L_ljx}ubΖI`_wuS=:@hM=~ iXh[lsߎ<ƺOzOF,pOFk};{^|^Uu QkݥG}&kv8R^u ^,έ5~3Fn i 3?oc݄^ns Cq2:ԛMݙnun2sE6v65;\Ď@SwK6w:l R?vD)ky")RMh,qkۚ@3xN'ǝLN+Q:l[ȉh4em%"S6uq-/w+*ߢu laY]jҮ9 F[AO/+ S4שU\8P_y]D@ $SudfwXDb k( [fˌҽ”4Ϩ6;]vbs݄>,_@͑Y'*Kﲱ]xd0US4PK]E6>ޗRH f0 <[~fs]hnyZzP֕%I,uOQꧻz7GSEٗϟdY %t dcԇ.LEVkw}HÁmg[. @Cagކ9Aovo<߽o__+/\}=:נ Clk]Yzh,V~-~aR7z!?>8wsm6m+(A4tQfT2{n븥sA9u~rGtvtv.\8V\jw-^炅 o?`Q o>g|1m`odrkZl[['*ܤw'FIoY{ A ȟu|9ڳɃ `kH&Iw+|8Xj%°쫱a}{~Gtoy #^yIX򮔱 ReEFEFk m3ez,e0NY ):H$5x̨vL3 ={s\Ip$q~Y9w~,bj,3CeJ3e%4un~x{CS'p \wZ 0%!lNVVZ\d\spQqvn ֒ NyYK\]ҎDGTysu 3 ䷽{ $ prF۠ҕ*?T ܱs8t&P1Dyu\yڃ Sٽf9YYY͚3{j8,Tk(MDEHgcv V/k`@w*!3`|-F\<{E(6قX/aQgpY2P ]&:ƕ(8=L6a>?B LuN$( 3}P{1x 4c\%#T߭nm\].3Aک>oc<[x\pej*]'\KkƗ>Ĝ1L`b ܜD!۫^⣕T'\{j$=T͢ź:ε#jd&#jE !ja%vkG;|=zuzW/{!YY &өYx#ON-J_:(LR k]p ľDYǘ:/,w 7*uu-gпk¶s>{. JQNrsesV 4L !RDw5=SP΍_x^聒ڍ8MS_6&\wh[ZFV+6ZegP~=l$puڊSuak,ќY:Ftw󱀸έߠiggҷYQQq\n#µ?MR${T t\/Uq4p2Net+)@>FxlYǬ2!{dcݍ`}j;I.xq0=56!aLUɒF x#LD|܇(l8k"q/c#:3=y,@AI|?0uE9Tr7Eſs^#D ]ǫ-J_*ߞ1_-M䫟f 5v)X7:j( :*F@3Iwor vi-RWb:oVDyO?`Ac]ⅺ& 2k:G3"+SMŽȮQu#!hJI$33][LxKҤMwֆQ-HA)=`8gx`21:Z|? aCYjlߧMD.cu y uZ<;DFvgwZ>=Ƿy!G!,Yk躧 jGv сH"/!uG68ٌ8 *t:χ;!o;SW= c1C:vїgCܴu]{*ӌP6_Yku*(>+E;b&.,\/L8m>™o])M೼LTm"]-c4 m0$-@hgʍYv7ϝ4jxeۃh4w -͗=d {785%)!~2"=լ'xaiIɍw/H-PjrjѣG9RR\k?吱I_gI)7)iBFRҞE]gpaAie*uZe fgTʽ4RY1&Z6qՐ{gj7|b}\$Y.wB\m(BPaIl]q+DyY%|{ ZZBjtݛ3. ^ۊ8QGq6>,܅M03Ԛ41q !HgT!-ֶ.h=p;00(>CjyN^M&,L4f/  с_n_[,0 ګ`u``\wp77;A L>.șHp)6q_$qj.ԿZco]P$.WWa17*[1Bbs׉q #ak"6rq5jed5/h$Y$~lw&o$n&y1*Q#%SVV7dCw1v`eᇧ$/ &ˬajzVݛp˅#+a>urrpLqqI Mf#c`1ʠ R3~JFR '8ڟH.*~U2iUHW_%2?s1:q\u8 tdJE:pIN| ΟE7o~E$ L9lF*d=\ /<}I_$DWmndElkbөYS v+e,Nb.jmUTQAĿ'D=gs}yH4/߄w9sVۂGuYUv{tͲ9'yYwrbEwd#YdY/I..'E7F.i,. +p6HM:AfGh dqc}T{Ou7nYl0.O=1πYENhF6p1NtŤd;]]):gzL<|pV$|&>KmyͬQKR\u܂Kw2YyDf[#wtfwFτN 7|'R񹾼U}כL$&ՑoK;i1^ySgz]c3Y IVwVO f]c9InRfbg0MN̲NqV~e|:R/AloR )3 #Jl=b &=K ;߂[w74Ou:CG4nF{SH0!brM?]\ `R&ru]7f]\{"p yuEgx f}ji戟Qs{]G1Uy(7.'ON;er^ͺuf]:&:h-'tF7Yg]Bѯ i8}[b]Ǭ};u˺6 j0 ]7AɭM>7V۬i5vnO96CgG˺h7=M9yZb@e~)UN4A"vd$ݥFP?y4/]js8d˺h1uL4 'ףMKRP#imDj饠˲J5hr}#T:.oda QYɺHS0ӕn/T ]<"%XQ$<5FE:o2搬SSzG2MQj=ER^b6PXBP͗жaߝ3Z?#zK.Juʯ<?YqZ)s:Kjun!XMٯ.(5-Vv zH;eKgecRɗl"uP\=񜳘˺h7S~S! 9dbM4%`rHX"ٳL."+x'GVbrtw0ď_9 .ç^ O(D~@@.RkQY'uE]EᛈLo޽F/ }}sퟏ'3+ 2?0HZ#:fPGaOpQ-2b\@f Уߔ̏zΒ@v)Vm!o!:`XC!iՁL> /'ݎx|[|:"ô'=4eR^kwC*'Z]O\Y9^YurgX}%"<0E0w^I}ʜkCqlԋ:ؙ< m;;;_6NzwS-T/鋫Қ#Wĥ)r8.z&O ʞ^Át`,@cpƩIꌗb W*[Ա;7,7uj{\9ĥh;m|)yGm'`Je-G3r'0Ѭȝٵ­@rqsj(\K~-V7bE7ZAyve=ha_ ?CguNþ2NٱXt vb!+vt2po)TTmEGF,k:y(ihV_9^44 /<N*]Sٱ4|'dS)c3g͓#G>֮燲G5C³fK Y}r.ל4#4j<Kx|U #y6L(s yIon,[u:J.\$c0NE,p4⬳ #uL?[bv?CkuJW\șpUPf$k nMyUo*Q'k>UoV0 ? ͶޔR6of]G܇ /3.5Q(`RAb@FsV1ꬢG֡#!,YuԑᘒN0r5G,ad{>frr*O־Ow&D҉ 6mD U֫VwI\d Jp7]c"Reoʢ(K^)o / m0%7Nɐހ_nuP^7ѽ$\on-[ު~)cy#M14s~N\E3 $W2|U ZѸb݋}/r6!5 ̿a4(O{bɹ1ЛDgV=´R0xt/ʂ}d$Zڕ"ͽݝmVcabѾN+d먣>Yhi}M1:VypQ @(JIR}eaաv"Q_fx+Aot;TaO۪o{v+%ynfVDeuP\iP@[ Ojվ&ѤL8"CRLցjDR^*}axHҬӊA~|! e>A [M(:J^hF2rq;;:Hn&KH뮗}}ʻѾһFɖv{ݦzռ.( \T;A)P-rxfM(qx|e(J;1_dY=T8cݫqp[U_ \[QᩩީE(rceUOr0&.كM{R(+hTƪڻPor,\,$tfV5kq"B>ZL9MYVɆi|d&hٷ8>01==c8t޺Buc)ZB7 e ӹǟȜ ҋx(%ӾNKKSIU Qґ:Λw ;d= \OQ?>bY] o `̖1xId&c8Bjv,X@J:--n-Y䱺+#5P&0dP_CxYR:Yzh O^B0T ͮVGF h#+ȝ04%;ZG#uJ[ؐqPV77G]jvwm~T}CCk)w-7g5֯^a_zWcSsܹ2UNQbn97V?Ý uJ\Jɾm.NHqYd\{T1M..D*~4cOw<QגuJq Ica$L)}Hszfk:^H_ZޑFS!j&cY,sF\M:ldOufUgǨmIqv[?L%+HcHgYm^9NuJ[潶]~:ۇ=Kp̺@5CO\3d4pzw^W֙1y;˺% u+D*[^#lT*p,}C7p^>ޥ۔pWbWD#b jolHYr>ᖋ6Jַ1dO/:?.V/ItV8!3\}|4ɯY1ť_H +l_m6g{gH:ޕ3tOܴi_"[˺|DYG0ք6'3n~z: :ɅO*dܬkܦ2cw;REFCG@\.;Urؾ DmR.Wr<8d9n7MT"vt3я5rE<d &+ GәͿϟֶ4@Ijm>zc>ȇV\}dz[Ԏ-wFjX$Rg Yݯ ; 1{L4^pSp( jK(mR9)USVWWGeeUU:jI8*Մj+i'vuJ\޽{{=zztwQFz7Ga]sFfv쳚PL~!q. t'jL̐tJK2 73F He 0bN9?0=u5(VQ…Kec!. 9tWR>zZZ=vXGe}&j.m?1QQyP,+~(cX E\Z$ɹsw.0'{E5:ZWp ;>@\oKǜ*fg> QWp& aD.q/iYSת xiW=MvѵB cL:fZW Dc X̣L\r` {]& xm:Ixӳu}eu:ԃQmegYC[2̸t%ּTt@g̖RWRr.A(~5*u@*_6F].e7WLa:@{&b.;%S}0Ur<P?ׅR>2:cU? @){ k] 綹IglsՌB_u[)t,W'ʸ5mf^x;Ǫsn }uOk^8^Is2{DQ7龤Ӆ>dֳ8{Q2s ~ٔ&g EʄTX^xg֭{>ܝ@Kic:p!$lw9 }M=8$3,} endstream endobj 38 0 obj <> endobj 39 0 obj <>/ColorSpace<<>>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/ExtGState<>>> endobj 40 0 obj <>stream HWˎ+j6eVL06N;0l#(Q%&3Y:?SRg źusYtFQN#&8/<8QbrdE4Y>>{œgx>u$dZ9'ӻjr*Udz3i! Qy?&/r5%',cQD+l|仗Ϯ(ňE4=P,cx7t.2h]z6=yԇ|?bD"Jry1"sb(LPLGB攋rt+D1T&Gš2 \jfStzNBkݒZ,tёn/E,L:SWne1-SրKgDNe":"{ga^sJ+~N7'Hռ%@;U5k]#k[`Ƹ(_+e=7TTZ}m:[KztʯյZ,.G42`Zda*ӮL$E2͜gb79unnҔ0M(7)8o{k!/uc)6 Z`agS3b*rkUE]^5yJ%K(c`4RČ<1cKfsl<_$P{r XT7M]WN _ h@@2~/>LJQGr?j[x=vtI^mu[[nU)mQoZ [F;%w;:Kyf%lss;@2SQTk0r .Tc^+C< s#s.6rT5shA]lJǷJuGtrHWؙJ\*W/W@D\٦#-`sABT;8E6Vw05juvN뵟4I8ωSMq$z;fn{>Em8T&)fivێ5H)N>dUrF-՚5}_3~h}Q(kӈ я~LFuZ;\y4ܔ_ʠ04`i̸ 48Y`]'%s_8îbi"vFYP7 a G@^shX,+#_)>4bIf0>VGCRx ش#5zGX>Z4z`EبTkקF/2Rs 7\7_~{+Ybڮ Q\@mD;؊֐VoĢ8r?˻{o vŮA|_cOѱVE4 HRej Y4(2ޗ=cɥl5IlDɩ? !t Ȭ$, !^$ryb:4h)al\=mSAjޢ&=wwJaGq.2y?E . fItB]*r?׎վ+g%/f>9$KiGBvV/6)('M;–`B`sۯ@|Fh*/ "iɓfaa:!e,v:t'^a40F6Tupڟysu}GD:[en%Wkr ?THdaIa=f{0f H  f%im4/&(( KE=_t,ȑR)a1dG: 4le Kye応Wn0" DJ$CACo1˱BC"W\33 we&0x)t3&M$q7 $o#6|2B n~BM?Ƕ\*O AMR< Sg}{ҼBk.A"1+9S#<# n'1EGM}·MU* ^ɽH\0JM\FwOui=dHcD6 3醿+bNq^L"9/&͔7ת0-Wɴ9;nP0ҎEF ~*}ֿ\Nw+eCwN5V#'`HV(JjT'vu=9E7E"F9v*'pG NXB:JfE ғ-J: #şT WFP~ ٴ:=%#dd@[ "5f &ٹyhy& Npkh5~bÐGAW8,P"Ob8iM!FcƪDP8kaso*jKZփG7kuc{S+4?f 0rd endstream endobj 41 0 obj <>/Height 478/Type/XObject>>stream &0'g i}idnoLIza Ӆ&6}q]/\@4Fk߮/K//ڿ i}d_J?2!_U$:u]Rk^USkaq5U*)i|&ªVZ{ aWXXa0A #TUx2p[:-xAN ipZu/u--ykAip^0Յadi@` m˂`pA, h YxA?D3xOA0OK_m-_I/OZ}x,낰d;X^@4z/\4}(a(2p5 ,oQN+ ,#P;oMB6zZ ~z.h+o/[~[{P_KK}JSwAl6q3 Ѣ^d2jd22<5L4pc\'A_@ 'JO넟A?z$8W 3fOa^`d4d&AX  'O_i_բiz-ރf uZXAu{ïҴ&_m~M5umm@ie<4CAr( x M{u'oo;ۯ6M_ /t|`PXpA? Xm+vv1n}pm@S2 h@go}mz_pKo_۴m7a~ޗaa/1 0VW@ 5-n:$5#a?A߄Oo__~~^פKi.Il [0$[`d TpA|.?l}ۿ_t/wdxн6&r@d/ t  dW_W/$:U/k~ *XaU_ /X / C0cT ik ֖A:Nֺ-kKX-aikւҞ]k | Aj?I x5@<X@H'WI~ IVUZ^낰. Ks KJ+tAG A: $ j!XP_SPIj aA~SwIOD XAl3 @ABu JAiV/_i0a~/Vd C9  ׃'Xgp_K Մu@ endstream endobj 42 0 obj <>/Height 478/Type/XObject>>stream &XAQ5 Ȱ pk^/6'Zazl/!!*C$, s|&ka:L'_I^}&k M0+ZDa}AaՅ{ 6`2p:[NV W v ׿L:&M׾a~Rd Pr@!  Yۯtݿoo{I ^oIo a\0 xez^޾ݥ^^00^ï  0a΀xcdm? x4+ᩫ '_< x7~zk^%[Iph%KaP@ *؅  xf3 {{{lOn>tO `Mp\#۽ޞvO:KxM]>V~=?zMdA}4א4uҼ i𻪯_z֩u`_mW놵^% j:X.C$3+A֖A-pu_KKNֺkK]aikւְ0ՅAl6'`A*=Hk xAL'_ל&(NXNZSizL/V/H*]js$/K h+8-,CK zXOJ,/zzZ^P-=&-zKKIkL/ I 4h(2A  4Vk^:_ נNzWU~^…/jZJ&_ z ~t+-*׃'h5z0AO0_KN ץ0 u|'ZJi?__0Յ5ayL f42Hd\Ԇ2 9a4A=zKxL'OJ B ^u־^](_]6_`Wz~ m  ޒZAN 'VV]/܆@.Gւ|@RUn]f zU IW7 zMWMUᆳ0I^Al6(r@!b( d}/{_n|W~^/m&үp|6/l7 ~a^ސ0l2ᆑ /C{zvxoA{KÊa{0`:++jAl6(3 i 鷯߯]~[U[% v\$Ke`- lAaX```F? endstream endobj 43 0 obj <> endobj 44 0 obj <>/ColorSpace<<>>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI]/ExtGState<>>> endobj 45 0 obj <>stream HW˲+fɛG^TR,[%JHE^%93uIKJE*J t>}GFt|:e|ҀIN/h2AbPEJ(/u3WgB2q{%2 xTH||BX ~N,iOi,GOcr7ID*('_A;ǂxiunJؓ߹7=aDZ!jX= 4Mh> x;4f2p^@4 71'Cy@~9 ~dԻ!1T[5aJ<)GD'1p]gMG̜VjjyQuȼ1閊ᜲ0M\eL{*4詴4;:k+贩UӮU"tJH/M5R);?Y,Hlʂ]ժӈ, rUaUekKg&e$␆((Srh"SҨ[R㱘Q /@I4Irȥ{_DI"BW+Ib~#mI )Ƃ!YU4@nBeQUj%O'uܨ^eU,(?} \ _Ŧ\dܔ+RYq~'"4yܛy.KRWLmՅj\hUwZn%-hz$@y[B. :Ztp\]گy3]VzQFm ۹ .w@zWZZd5L|uN`kݑ;kMg׬#*MX,gom]\ܔ]{E4e|x(Fp !@Hԥ*e Ğ%{gpSWU6ƓOZ EX=p8wpJjje6-"7fD|7b^l o"wGdyq,Y4 ?PFT!չl@Ȓ(:\S$NB(Jz5=c0 vhyj-κq5uä uvca0+]o,`} )_w24쭉#-%.^7nmH9(w}Y1WwjxvIn[u%]Q៽)΢'S9q&dwaY\Z=$pJIŌe;h *0]rl$I{6|$rmwlp߁hiȞ_FgaQ`I2!@flW_w]Ze!/O$׍ٸG4H G*ٚ=Ptg(!aq #J!5Uۋ VkD*јhj஛`.s562UdG=ҡ[FЕ-cBn߫eNCS꽈z7; # ,ޟmqښLבҌOxp F$Ain@II}ʍ=Yo_-'d>A#GW_nmYX^355 QIli&AŞpD~YPICQq1a1Ų-Q㥁}gU>Ų4ɞ+J/5^ݮz򹗚g#r҇@)-#m&ɼ5oƸ8﹉vί *} endstream endobj 46 0 obj <>/Height 207/Type/XObject>>stream &>@Y@})=Ch}i}~AcGͶ>hߵ~פPVa; 6@E BAot xK`vd_f|  N/E@AȨd/J,0U4ܖHktʘ-%@M `L2AV$A9Z /!#APRC,9٨dK߆Hk@߆HOאq" s$3@d2T9ށ~ C&I;. 4l@f ,^C$5dȜdA\Nv`2C$2@+@-P @m H@h*@+!B @6N C 4l ea! `d!ڐd0 LT`@5~ 0aU ` LzH0ZC4E g yPE@ &)8d2<د"D 40Aadjx"6 AKa@a y TUkLV AA?H 0= ,&8LK L'1cZ AB-/Ii:OM>_(P%?M4NKҪZ_U^.UiJC a/W".U^/KJXKz \SI1IsILa% l 4Ajiy!A ,<<4@AV d!Yૄ23 x@V+ x@$f\C A2l!k 'N'O_Az ^}/}'}'UI-V@ _O~?: O/a>K_ׄk^K-V/K%/XP %/?%xK ^_a|asS^a<?K0Ix`/ X`t /=K<N'6@? pdt8|8A^@l+_|_O3' ~\ ~^.'f~_A|-}~__A}}/ӯ}/ __A}}JO}:~_K~־K}}K~_X_ |%_k+__ }ȳ_kK0c /Jc 0$}!푿d3jAI YY  @V<J CO2U@V<@V@Q @X x+AV dX ̈́Jd0fbC$\!kA?H =*z '}']}}Bz____oOK_ |/}.^]H+ҥ[ __/ % _#vaa| V k `_ ' BNoN8NN8T@a\H)WC$C_]?  Co K_}i2zC޺/_az *"2,/_)  ia B?^ߥ'Ki__Z_xK/YX^KۆI?2}7' rO<1h x @U<`Fd5$<4A x+AV C ф2jh x* \ᠬ3 r%d0߯ۯ]?m?_Mnữ_ o_kh0V?\ @ endstream endobj 47 0 obj <>/Height 207/Type/XObject>>stream &he L`  V0"x$2A<0<L`2  i9<L`S 0<0p h NH 7dp]_@O ,0= ?  '@/N`l?a_ z}  7i<# 3U_< 0$= xp%z_ -/i -=q?heჅAiS~A\a-*{ p O p`}:ײS U2_ P</ VO ٹVH!As <3!yq|^<4QrX ׽d;d#I 5 xf(<}Nl472 '~ }Nl4 z>CVv\2M@Jv\2Yp˶ l! P@ѱRd}3z I)[jh!cv@ϱRds<E 0I_3S0Ȭ0 da;!f3 %)@ a ^ /m ^A0l fs@([ a f 'pa2VaHXkL 5a/% TIXm% T`|r!1 El@d?Xd ߓ0Q aHm Q* d S YX,< 4, E|!`&<Xȴ0&̜ A SP&I@@gS& /ac@>@a%;t ߀R)K:<0`k$ E@|X2>Pփ82@L4GC4|)$+x+Eռ]d qah6i@ J ԣ mc%1 d2G m%d @ eW J 2%`-!dC 4 fX d @,CJ Ԃ3  Nl  "` E0AAl7XA {" 0E@46&AAd[a*I@o-%h0p< %imAl3v,N L@6@d2NApR @jǧ4l@f(6C A6du~@a a  l@'=l*@Z56B M%@wB p!&d -& @}0EXA64 &!k l AA6>L"  M Ia?!$SB"8aD`htD@gռ l 4!D0 [A !O6D l7A#@T'h$AR:lOG@A DCA D4mYA7H I ~ I 0AO&H m .< AA A I ImoM6AAA6TҠ֕t moDn V@fCd <NDZ ʮ m xkWM_t4A MHpAAAAk*&* a1P7AE[4I7I6I6/ A\.K_ROMdY6I6d8iW~ TZK i'Ii|%d$"@sxbJ"T2]R\@(*_iul4հUx*Kj®@oKl }/% $x$\"@]u$p`x@vјi@ x)@|?<;h4* { <=y^k x=zA& DD$ A A@2. < 1 oK^ Z M A0NtHzZ]PZ T(Z APAi:M I'I =-yBZ oJ4iRiIizZKJ7Ҫla*%Z4U_%UXK Cx>/Height 205/Type/XObject>>stream &x4 D0` fPJLJ0F d4 i%@x#@z%@x)<@4*40Y*(H́p aMauK^0ޟI}'mo^_Az 'mW}&/K}/J+z_K/ xJ޼% / [KU+?𗄷 aBK[h|-…PgڼKK0˜$$ `|0K _ (<~  9Adxid,8d xi!%@_xEm:Ʊ x4@Ko?K /KK _~mm:&o,/_ __}[Z_Iu~|/[%.~}m^_K__}/ (__}.[K/K_X_ _/0c /-0_ -,0_ `ҿed xQr|@H V@H x(x x)V p@+!xA,<A p@mbd|! 0@o  xAH@)B 2Z']'_tD qI__Ko]*׌/ oTK.A _ p\-/o.c c I// x`/8NY8*pdx2p< ' ^C : kC Jh@%u9% AV 4Aa?'h'_A /TKOOPI:! *m?~ORW-/Tҵ>"q+_Wc k/v?_ 'P@ rH x(x x)V p@ׂY \ @Q x)d!  x8 x5 P@$+ Y @5A j+ xj Z '?o oCf& K_MA[/m ;/, DOa/_a  Ç B[m2p+@o ?'Pi<4iNo xk %W@,P?m` %@_ cҕ@KK?dK?w@ ?~r?W-/ 6kT q_" +<55j[^A_5C^A&AzH ?RD7_R)5켂ېT1F!ڀP `o @<>jl!)ڀ P-=sx(0[`S ~l v A/ x}?mmG/ xnOnv2xKeѵz^CG mGy8YWbGK x5/ڰ%0Ad Kv a: tƈ !( T{J@T@@2$@^@@,B> { /u ^!xa  S  endstream endobj 49 0 obj <> endobj 50 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageB]/ExtGState<>>> endobj 51 0 obj <>stream HWnH}W0/řAYYwca&i JTYd,H?wÜ*)R4Zz>yyȺ=[̞,adq5Kh$'G&"$Lsv?d={fI]<rv3,Rml>\_k_0Ⓧw(()`fېSw r _= ϟ=_of, 칄g)9HӅ$#6^r}γ>E#o'8$_\ddKHb&D%3&'D1t&R#Vb  _ژ-A3}k&ۼ(+ficSlTWeEjH;+ӕ1 g2+i|[|nMe;ki?%ˢWPf$QĮ[}d A|xG]Y?|4ܟF 'L1b_.Td[ YT|ɛ @F*H_|.%>S_̭mK }F1#dMjuJVNMIY?51zkR @g?F,r("N(K0QODib;L0`As|_Q'D+*cTr_^eiM&䵃*yѫS4ڥLʘkg.\j}/>;c `tʤ庀sT!n,+5~AV:#y3\u`Lu>U^]wMc܇&ZW{c<fSHDBtg{v5}gg!Y`1kE$'onjKngO^o%ȋr.}ZCbضBE铋OWk w^4PxT;y4"iz=c* :rr_`%o5T`et 愢%Nۺjg>/mk-fQ偕Ve4PiH[_o oêHٔ5va`}6ROnq@ )vVonl:[Bqt]&=K{#l%q@?kraEƔb*ȾӫdYUeukҩ*_pSMhwO{ID=m~m`wŹiJ;MzUXQye֐o[a= G V a2LhjZO\$+nEC(N<#+o.ւ˛Ӿܤy?]V:Cmnsr o3ze6uX7A;Kº۲= iV~ `ab5^Ժߜa]o'wQB<9$ͽΰEd$*8#(5􏊆|}wg =ab.^̤SכxKf"IY\*rʋoVQsNİԱyLR'J8+[ȝ>X*[nbqk gh߀5+600vݺg&"@hB~;NB+?!|"A [`8";y8ȍC6*)=JmDнG;^<B/pl>p"d< ?*a-2B`Ϝ6Dݰ "H|ӮzS6lۯ7> kOBy0I rޑQw>/Height 427/Type/XObject>>stream &4C$Q{{ooapiߧiC Ϯz6Au~п&It /M_7 rQ_&K h__2Aj/H?_J0 'K ޗRy!_Rcm=ֿK^*)ium-UX+kֿ࿰Kmpa%dN#Tr :[a:a: iiBZ_}ֺ-uaik^Z Kk S˺L--~ ah-u)!AX+hJe  -?SI?Q $cOZ@!- ?j(mG~ __-! u] IZ @N aSհxK@/MӅK7--KCn^-!:iA+}75 KTpZ^ҾT7@4 ilX2 5Lcdh!a5„Jߥ=&/^N0^.z 'zW>I-pH? [+J`^B~aY1_X2@dW~90K}W/  ~ _M/[CO~[V c! -@!*@r< BAA 42: ߸_ P@x(MPIƛPT«*P ᴤ"^L +xa/Do P_ @nA7վna-&/^?AvVx/_??O??O?! -@y/dA \6AQgo ۺX/࿻}`Q_ a z_\0҅bzPoYiAMB (/z_aMaA:0`_3 _c!dfW_[P@x @#~!SM>/Height 427/Type/XObject>>stream &xi`0"))\]a~`*F_|Wa}~X^C$0ty l5:^:_5z^ׯz\k^/KMKZT^ /J=2ƈdLd2rjaN@A𿠸-: Z-kx-az !]]=d5hTnA7ޓ~ޕڷoKxMߵӷդ~==޽7 A }Y a5P?^;tK 'N/^_z jK`{^HtU4}|5^ K_ /I_HeQ-|(A:(N𿥥֗%K^>K_kZ_VazZ/Ak$қ!Ahz@pA< x?pOK&i_ KK_/ZK:m?KWK*_°V^h%kHh>O /d$^o=%Q? V/ ~Ht|kp/Jp^p/^x/Ua75 ?A0@4ƿ h4  \ , x*C 2 㒂 f ]!uׄ^A N|_|_?(_/]6 ֫+zL!KՅXX_ Z~ ׂ?}/ ?ү`AN~HzMzO__ pV~ қdZrb C82Sa9aA: 0&~ D'SZTzsPiT&~T: ZUPX](SwmP_ ]*7i0_ oa&N߮ !Z0_ Oo?]!3:(Au_Ɠ VگRn}[a/V_C C< d"( HsAn҄vAu@ endstream endobj 54 0 obj <>/Height 425/Type/XObject>>stream &98˜ .) 3H ZzS˦ 7^^ޔ/H`{a 4ԁ/_{vۥ=/oK+ 6װ/$=x` g@@ |ux+ day lV_[P@~|B/}B dT;&mWIo\% pA-%aH !adY2=Vvad5 C >?]1z>?]-7Mz_7M*Pla?}Jw^WOo^Km^4a:ZT-z )zjM_: ֖:MiVaij--Sah-%aa/H0ZZ2p * \rқ!A 2a#?5BuA:B@ Н~׶]a~X+ƛ_hK&az_ 'C BK =z_/?ׯz_ p*P[^l/KP[ 㭅265AdX d2W6>k:Kׂ /Zi/|^kA}'./\%^@,%yk\%> A%xL'C"B 6/K$(z_ޛO_Wa_ =k_פ V5 @4ƿVXP@0+ xQY AJֿ0U &JzMBS^B/0I5  DtP_: /NIMH`U_ JޫX_VȪ b>FbU nM?dJlk!!d C$  wKvoK 7i~oI/ _pHgoKK/z ~q_ ~0A~0/ %2AW@4ƺڂ12C* ~unWIo\% pA-%aH !adY@ endstream endobj 55 0 obj <> endobj 56 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageB]/ExtGState<>>> endobj 57 0 obj <>stream HWˎ+jZ5bh<όv⌀ATv#dwd9U|$g{{8YדɳNIFW0oԔe\T0*ȼ0'Ͼ};צ%o^L,珓ϙP q \ t'bcpLt%4BhOƍjfd&)"3xE*M7m/mޑ_LjYw?z)Fl2GD Dr '_ȏ4!8ܐ`d_r2͐+`$Bl'>kS#,n򪬉-$/&IqߑjE۵-ɪޑ"}M5^~ش@EY[eɘG;s+$o|^7VqDc'F筿 ٵuc],q]JTIo /-nv1o67mzw_H4TR 3,9B:"|aFW|z,}]h3QcCE+XSd"tyf R f.m{@27d޹P0 u=W$W0WsBƜ_|-Yu\>|#(C2-"- U]$9M>˗[_2׶j?^Hj4Ry&yX3FM$?P( Q-(FoJ\Ylm ہqV'UCc-v1{a} Z[ FwPPd*y')ϋ [6 ?#%D:sSj?|/GȎZG=Ô|IֻU%m~yP?97g&Eg!mAnP PYo + ;mYo/S ƃ:ch`${LQIȓ ~~GLSƮ~|gA6u8w̫'c7!d4;}yWI~G L #Fg>glkD2@psJ74HH@q LI2LNʣAI0tIndh"RH!h5+QMWJ4=A5t0;se,^}goG=Gfa"]_\',($T$(@ e< >&!GYN~ğM*,ڐxR  E1yP/ɷ}OR<Ώlj!ǝ39APfPEca$qkHeH@/sF"g1Zg_?|uZ&Ǩ*@;eCVD !Y9G\ZH|l5AɆgۮwח-@V(hNO^zWf MC']Ggepa b[WXCa q.b|tI oL^V.m|D2˓( EчXc\\@5)N>3y//u_X+tG1 Bx]!0[bt^⹟МOPQ_u*AnelOz49$A,et5ܶ`iN&bhEUNJ 6Pi}QnE?ovCv,*ݢAϰ}yYu lq<(:/-d:QAE* ՘Ĥh@UcjTT>&N_u 8}F G{.5$:XCqȢ?WDQ~ob!CLb8y0iXZQvDCd+)ULWoC?v"q wMC\6t"A$Z* ݝ%59Ec5PeTZ~}q$gdllj CE!mBfZڛh'(7uMS>-~Myu'f26JHoAV|cۻ^mQ*[ҀBp?RvcA8M7LD3k"B*|vENEfIHz;3o޼Xbzg8>KCrqzP>;\xU^|*_a{CDC!/'3W>s{fCkRi=89SQU_4EzEzE"^|BBΗ8x=&d" u]iH*1A;lm̥d=D!-0f Y]aob@j8xzD>VpI>/Height 306/Type/XObject>>stream & <ޞzzxMM A_d BGd??OJ !H/lIK]/l#1KA}*-.6oom&TVտtVտU 5ϿJCJ TXMట+ r}tuvz6^O.a@ a} ?M\A ǐo(!a 'P~OP'_׶WCI7꿂I|{ oVh) d! dt di6!! V/-8ZM IzZ^tpW\_ iz i-/J?Kap_L%&/J+VswKe& J)x ! dC$`<[, V/TPaAz+~(]&AiFJ K-AW U_-t XK`V (dQZ\%B??ipZ-,B ǂ ]i`׮ `a_{ }M@muRl'@9 Ri.  IP WO _4MzMt?J_O0+ xҠ 7,> maA yƺL(_aK) 'd֐BP_[ r** _"M#1 nu &WU&Um [a2a?!d @ h2@A I{w Xn[ݾCoiA+i~% a)m P/҂ _pJ RؽAxޔzz_iB!7a}~ޗ__ __ ΀{_?_a~@+ I~@Z"@__ _^_y||sP X7}6\_\z/|zKi.Il [0$[`d 1 endstream endobj 59 0 obj <> endobj 60 0 obj <>/Font<>/ProcSet[/PDF/Text/ImageB]/ExtGState<>>> endobj 61 0 obj <>stream HW[o7}ׯࣼsq&)] ؇X#b<u8ۇ}{xH)bњw=㋷WܘrbL 'ǂ0 K<"`T z(\|x=7v{'%ҽ-YզoOVwF5g6#i,/9L/sǫ%99g?uDW?_8칄u QD(Mrq9ې,r )o8&f #+#+nvǍ#rWN{bz{u/I[\KV˿x|EdJYs3D۪}͍a crCmK3+bXFIJ#4-hbٽ:H`wLJsP,%l<9M 4J(rk?s]<tF%-DZ.&.ej2+r cc~7dnz@+|23Qx.J?kD` Ϧ2W/oSCAӌ' h,M@N3ۭZ7mi*|x+eL›b?g/1_!^kb&{3t̿R j c-B }d_[XVzYZ3(,0AKٿD7Nv&\Uւ :h}^83澳ة;%+C >;Y5u^.muKQ+7֣LKw3Ps2DpvS6kXknP)C5U$$;TGPGG9y^)Fqӑ(T l[*P "ɽAv+QvnsN~co4 zȗxA%'>K"TRWN[qWƨTO4a|e"f7RX/vU׵{`٘u.hgCG"d{Ç?Pّp!c$!mp 9 "۩43;N}Ů@}cW ž hS$L^Gi`'֡gܴ9Xkc߷mOG9BrP'ќ%} zo O~ PujIUg{d]Wڡ'd#Rvץ68}Kݣ@@փUYʕ!\J mM |Pvw ֺNṌyZ jd&1l_fPT;U8&+^l A׾Snw,۫h@spdUUy)`n$vs');V,I(!i7s]jZ4e*i~tj՝ջD%n;FgvVfmBw,ժm,L[=3MRNrnU`B7jgGZ4lmk bmڍVG\dTim= ʌM+[kq˿UCx ɳ{ܵ1[ gD*xJI4o[=FM,LLV7$Qh F#a`y'8wvvDq+h\d;N8)h5ua6-Qʾ \YE ^v+C^aөM5~<}JP:Aln,?F퇬^;Q5֓Y A(PLΖr̔vޟuOOru56#y.[[^np"sq;+ILW^?} [=IKiZ#USVK_Xemn˘WPc%,]cЭLYj=^@ 9q[=n$H'8, e0^cIT;Se]#vRY6yKDW/Xy/0< KuMW߱XZQ:A1!1vC _ 0[a endstream endobj 62 0 obj <>/Height 317/Type/XObject>>stream &$_=@*4 =aW;_moO?SNm_t,!}? & Ow_wO^ a o A =/I52_f! }z_<AI^ //^_L~K^¯k_KE/ª]kגpa%x) Cd/izX(A /K Z(_Kҍ:IBuJZ_XZZZ Tf\L-/K" !*q `dpV h2Q< |9(NR $ ?MK~_kHk_I/a|W@7F bKKC'`ׅKE8I|? h&ޗZ Ҭ_U+Ҩ-B u&}-T_P-% e-d ȬT2Z,344A~N=(Sw\./ҽp넿}l ^_ 3+! #L! -=pI  pd[X@`H> f_i{ho \ }paZ^Np/V'_I[a~ m@d6x !Y H !9  C΂AK?BBvI(O ]O [om/wi_ =&uxa:  _d\7m AokU--_+~yzv}aWS?/_e !d C+(q@Zo_/~mq/0pTl7T߷ pˆM%b$oIzMBI, &zA 8a:/0a:?O x4m D~?߿@Q?A߄t?M~~z^-K%[(l K` lB<  endstream endobj 63 0 obj <>/Height 316/Type/XObject>>stream &$_e@ oICR4o ڷEղPcb~?!9U) d Al-n4,6Waa_k MnХK?0^ah/l /"L0aw el| ۿm& ߯6N[o} @ ߦz%@o @ KIM3 Mm?_(@اM?K3 rd+! 7^ 0_/oWCf }z_~ _UKm/_I]mJT 0%[ Xa%C 6!kU8azAa /M!wƩSB _~-A47G!CuߥaZXAm_i0KK^ IZZ˫m6a0lr`4PA8=Hdx CAA WJA G__@&|B f  m&ZMP__M~ _ 0VPanx( __/Ky@j/@ /@@ޭԄ_&M7JjzM& 0oH`_D4^!`4 x8 > h L@58|C%f2@/_P+ /m_a xih*l0 Jհa?_ c d7_ _ m!#1/| ?I__MmOMAׂ 0@dX5~ [(NC,TL|AL  R >'2VtAh#ۯN NA@3?Saii7ᴿ][_&p^~a/V`?mVU[ӷVo_Hv†moaᅡ /HX -,y/dAq>!/v ݾp~jޗa 4zC޿__oK0 ï 0a c x4 xj~@f~?;om_zIm%] -@ a[Xdb,,F? endstream endobj 64 0 obj <> endobj 65 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 66 0 obj <>stream HWˎ+j٬_I0{8gX bI IuGdɧx]vySRm$6d|ܺs={Jn6(ddAH#!K (' xFf$ B!o'op}c߉l۳/C&9~?//rGy$`cα(ba}ڙ2.Xl7%W7)x@)0Lq o[=z#WϾ7}CSaau ,K&A!2&AS*(E}&}J!?0H" |}Hr 39:h"[SW>aW~-MSzmT#k":kAh2[nErv8jl`Tݪ΍E]yy݊T5Vv4jUUKڞٲ~+L S_uۮqܚ~uu)+2/dnӏ@ x]T];O̶U`SM+r~jU^7m@Umd~M^Czjڙm"F$|vv9襪U]({LQUsI)urɹwQ,hpma~lIe@l P0]ty7c]J p$E$hDgbP4YHO@LaɃX&UݩKi$@7ڻ&iUj5p1GLuHi"zZD,`8qtltB$Oܓ 8QӈoњJݎm~ΑɤkY"O޶C!O#g`ڴ3mcma"-nmGMFݒp|p6~7iӋeO_pnzveHY@Km&}x+:G(nHmb mmQ{^idނT%*>(9lbC$A* 6<%hѨ Q\/z-lAh)4BQ#i\`Cƹ4ʐP6:hW;2zntg@KY%t}8 @7YJ],z(ٞcoOf äOczx,IWҭ(@^Wci*ԓy{+ ?cz,Ѐ4c?]۷7 fW(1x)jѢmk[{7lU@DQV2dn腾ˣr}5r |$ Sn%\8w%uwl\F,tNV &T01 xI|QA a>Ti U2v0 {.-4}A_d)CJ~/J=pQ|L3nuKdhzl$Buwca/S=Е`^5հx#0v;TP(D9"g\y3Aנm^Nt1_,I.`2\g (dAuo?I2%MASYC2zP}wk!۾=17> 7^WGe?(Rz2΂5hl ^ q,h21vS0h߾Da# SiY֫yoWTh!jfAT@R~ n>:QvQ)27`"j׭JpDYuݪ[0~yf93ln#ǃck䶾),ٌZHxAMt[b}ҭt/gC.kpw&$Ht wg+Q v=/3mNoz~pW%Qz4)`+LrhV],qGfzbѹ&ߴ_є?uOrU*Ӈ闰m8 x9J>M0 Y }n_rL)Ϡ×Ϳ賁!wr]a$Xwޡku#f<S6|zqE}3l $<9lϐzXIv:,z↊NgZp:ܰ8Pzf矍^ ԣa !MH:TC4"$ދ2C۞zZrjrMN2|/ocy:li7&QU(5[`dؔ'`:a:t+즱|Z2g:DRH#|XIG "S+%zCi1Jܟ7w:IYӑos:VfeKfWI)> endobj 68 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 69 0 obj <>stream HW˒6+TOI47R~ݮ8֬$X$!`Yfߙ?dDIĎ%Q{^QVɳ"!,Vi# iH ɢd=yūi}O{1|=ysNB};q2PZv]Wƃ , q⥻#2ẉ~K~ofdzC9݋_yG~^Pq EFaHhId~ZiҫIp}̓>Dp4&0Dޑ~2q)$)&Q{AtxRNB"0J2Df i\qnrK>YԲz٥`2(͒=*E56xa@Ҽ!QlJ|T&aZȚ'z_bBYB's990eͶw C|~};8nw5쑅 AaJɜz4H8w|Z% jaJh͗68Ҧ|%FoN3OS&i|J@ 8ow~pԛsVlN; Oa4c 2Vyɪ[^rO|HV6E?X'Q6IRjnm.1v晳fxVZVz *\U-Y#f%Յ˥ozF$qg\- en%S+Gnj ‘r?#e rdJr; 1Qw*^QHs'h4nX~\7d}GQ}%E4PSsBͫl ضM7gl⦒iNjQsA7@e{lv-(STi9_l507Q5Am/&E+f<+0/+1.ksʫQ 0㳾eTlj8;cðPZތۛx >67h9[I=ܟC;#!y#6x9Yչ6M([,cj4 S\NW${Dv6 i=5<ϣoOIˤKbi(B ZnY0r^"߇[Ӄ [32vL(ӧF:HFÎn KJ&d1rߋܵH(GC[Kld1Wq`1źzoI #Khh3ؔB7(:=nxmȎ]^`^BtoCRr/4pRF#=Q w~FKIiEZe)=SdfCߝ6N+rߍDl{ AEO!,!rNq[mչOiO~XF2kʴ u+OqAeW^G+͍հ\R3^\/f1pȻ)J4 (K2넴wJ6t> àϺh~BG c:OOn<D{}Γ.ϼp,C4 tMژƣf9MdKsOdJ# 4t @f@(B=y.}xZtL4l%aԉKۖ˃| z܎'kTROrןGaeYc?4<փDOw\nK+Pٙ[lGz=Y!v?]\*e6Sw"FVV+^)gtx!bΦuݏbH_ݬR*]DX\ueFFQta|!W}juxz{i\F\G?aΰs[4"Bp:45 O`Y3mϰ,.,`P [](x f79AɌ MCzB endstream endobj 70 0 obj <> endobj 71 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 72 0 obj <>stream HWَ}Wc;hѬ"0`'cg`y Up}F?!VAQMw9s/_Bɡ^ݬ^n6Pٯbǥ>#.ۯ 7 0d\?rXߛfK~ W;|_{8$yXr,8G3ߙ~ ̃͟i- 7:bϡ77a eǜS[I3y5:ԋ|Iu7)=BŸ+nGmfuȭ:+J>7:!'0O>d_RnHH}LJ|ap%[}y #Oog!5RY4"K$MZ(ȷM3y8ɑleV4%i,'垼Zjk{_[' qF:DX8ȡ& tuZ J˶&NʶeM,w C%NVd9 /փexY"MX2M+rW}%ImPrE[uc7]}ݙ[ILT*{9 L9++٨rd_VHCdZ#y`hk sq')͙E136XW2 Ա:  tnM$kwnkۺͬ{ƙc_S" V 0D]+-PUwVwi}ўrۍ:ek7$-D S;!6)\VnJ:MD~$n4z(<bmy w,prN[?U-{'ehZQԉ}[Pߞa6h}h>nЛ8DDt Z HAʢT^LZf{"T$9-h;)K]R+j]mS[S&9"ANJ$ATO xԠAKR@ ,˝CK UBgVʐnDI-rRie` (m_oHWVr]_VgFd,5]V wJ[,4uғ!Ƣ*)DZU+<]Px3qlgPG R9^/ fdkbk}Z;[R\Ba@{-6P I~kͱ5#r׈( fnu"&>cᑂGTpˣ We&>HM{sۿ"ݣhnaWy~~l $Aӧ 4ϊ :* (9A@x` yarqH 2 h8#Xda^HG2fc&s!o%4ƎG؛.x7G r=ٽ*uҴf-A͕iTS}[$j)ƳEǩ*O(7dPBQCtkE7rDlP[􂥕b+ϥ`ͪOkUJ$ՌM/AVgϔ7f*(;:Ȩ p%9y= FrܼIm0u: ]<`Y2<?S٤ V[aQf'[?kvOաjU[I@ծIɛ<ߒOBf9{#G#͝vdK`S.롻O|;̤dźnT8ϋ^"ȋ}}̓?eVXY p*ȗ%;TqyZ=9dž> ( G#z=Y z;@|]0,F?6CeӞSۘ_t`K <֋2|2o3x߃ ?TOmb30 (0Z n@L>%&^[<@p*F5 NM,fz+ٞ]ɽ'Ek͖39c;MǻuU,fPGV\1mkA2j,*ܫ#辨A_l FXQC> endobj 74 0 obj <>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 75 0 obj <>stream HWێ7}W 4/`,Fdo[,Ld} ?d7MMiX5꺞:uwbקëLb:=<(a 5YəOx3|xoOoeoÛrN󷥜NLs^~%Ǽ̜l@!\hޝ Ι9~Y1w|͟16Ap惽9!|̂R>|sBssCzsjÜbAL߅8zM?L?ħk/!pJ?LɿvJ:$/09wP6&r)rr,t~$xR?g~s\ߛ?UM*չtǩuB <=,,^k/BaE̱xNDorqeBo?i%ӯ{ojM.X54u`lnZj-ڑ~`;yUjlg91k]!v.U wc] nDrc87jPJ2L/ ::v<%7YJO,u4Q0XѰ5=c-|ʛo]1y0Fu~Mf_bżdLJ>e#J.nr.E;H`-2eal\˰ϝ<'` M8e:8ǘΉ)s'AJȑt@ ս5'nJF۠)YL5)6TE軁\ zK.PEN3cJfL{ k2g &my:'a3f_ ,qagv(R4@ٙj?^u@Sh}!R^>ʦa@M=N Y߻c-n-qKKf($B<#ݎv\Fo1).Pp9ٺ %%I> Sᵐk0 ='0\юSRb^!${P79\O- Ң4dFm}7V"kZiL6omoIeZئh\*z(&sm^rT0H$H,ڰB*p?H][ߧfN[v7-,>t=@E(r$R7䑵K+r.񳀑w~˙qK(:f2kg]ijl6p:ODٛdim! hJ$ktW]-4 a*V3J_/A xb8uǶ)k @ږ{tt6K!ajSLآ՝W@ K6 Tỽ D\ a}hHf})2Gn萆&]gWeAg> \am*EUZ]}ѕe][Q<]mĢ~Cw|َX٧m[axWԪJ 0BJ] !E !5g$% $R4e8הP/A lX%j"+QrjWdT`y]5K54H,&#vBͪ.EAX _mKkϼy/b5ʐlMSݩSD(BV݃ۈ9Bv)wSms p%RQW=5tURȈmDo h%LڄN+qޫ/"YD% Bj@]n:Qf#kM,Sh?!u 0']ݧK,J}aPnOanԙf8넮* x)T7!i3vT2Bd-jJ+]X B vfs˦?p"37T*t^Ό9#(wIi^l6xPX匧A~X!n\0T%x^n\w,w: `VAPT*I%uz_ S y,+QJa:w\W tL$30+ݗIEMH&%4EG@$v[O'}m9cJZ4ZM޺mw]Yg'IC5rNͺSUQḶ }W.u3RA"lb}a.¯R|FjuNۗܠΙ)_SDDž҈hZo._@t K7(%4/un$oS2Q9uZ%Mwy#&p]|K`v4yv)ʀ S@L7TCQ'[q ʴkE(`A&2C-*+֭3k4F?*ڠq<)D+77aYv8*i zRq01txC_!V>%֑FѶ}rsY8ҵ0cK{ȕ\_1~ l8,:Qb lY,ֽ-ii`Ydթ7FxEvڜ=C斛ᮚp #v_h Jamu!CH>+&[3l0_+g: 6q&pOU3A {zGCsnUS!A'*|33cenPWKv)H)%hT;5|^~EI \J:\Na (ψx_URmV辐aIwdBi~,,3umZxb !Nl}7CBg}lji#|8B'>S}H{L ŭIS ;n,6aHxnmm9.ߦ 0LJ#0KE"ĀW*G0Ƣv#)O ^^y ck'ѸU6zgo+儐q7DQi(mC (z<$p0DEW_pDV^"]E{M%,k;'1ÖEeH/vp<kf zKaפm,@oV)k |n8ZTg/%ےMˑ^V$ kK\d`Pj @mf Uj@U2ɐvʑ"(|j~Mm-8yDϧgCCu_^!{NǶ R_/czy6C+yVThI6VKR/_Ѕ ߼Su(pbphGF4wo 60i@Cq*1bSފ8|YKyDu1\f$X˹@1Zb9ɧYg+v`o1 7mOƷAj:M2ad;_5gpI^ܬX)iژξg P@1Z ,kٍXtFi+燕[Ϝ&l Gg4]z ?S8Fich#9kuׯD\40[>X.O|hاQhW/'}zow?Ç?x 0:s endstream endobj 76 0 obj <> endobj 77 0 obj <> endobj 78 0 obj <> endobj 79 0 obj <>/DW 1000/Type/Font>> endobj 80 0 obj <>stream HTͮ0< R"eqۨI'Nni7aw軙ip'?cr]뙐֌,]Oo> lI}mW/,6~+{;k9=|?3ʒ>$iь_g3I,$CcW6\q%}z8.j.ľ$jH+ @HDIMAEtms'ƚdk6`ΌyIuB@?eKg":)9h3N 3h.AT KѡYtd3ռL[1f<@^CTH4BOuett{* 98m&9t[ +HL55( *p*4qNE^oT%PSS>CE,s0QD e&z;~ ^W=iɠK^׮8\o#', endstream endobj 81 0 obj <>stream H\U pE^τp#LLa"D p*@pQCȱQ1(. V؍,r .[~ɺ[?u_ ?pHb5O -ǖ߻u`1@2Μs]&J\!\4yxmqgQw٥E<emqY5;u/R,x)+⯑MA޵T׎_M @& h~tZ nG$%nbo-J2}.A>*G!`7 Du8g1 pE:^MaCPdadDڹ#yF$s &mv"Pͣ b dD QnZK$tN[o'&s&js\ǟ-x*TN:~.i 9i":Ӵ3:Vi'ytDrld6N*~0,d+q\ص0u٫#ɒ"U$ƱIT~N 4MM3stH2| $чt=jmͰSzqȼҁ^VŰZhaF 3"~S=e7D**\:cEA-GS$_U>1Y*或$AL Pi^ IAP*}.gm FSλqEH^$k8~n)AQ-#mߋ p4>Nϓ;xQ\YՈjGY^*S!ZU Hz`% @FC.*TXE&E%r{oRyWp"ߨ~|k0ѬAnY`1l4ϢCL].PV*5F>{w)n<(VpF=O:CiSh|aRaru5 PM󅺄ADK(d*>lvԞhmof"װ={<=[Z.SJINJء}|ض61Oj≨MD4n԰Axz!Nmi%x9@\as&Զ>v~Qp+>Waמ4re #]#nn5h$Wvݿ~ .oTq+ .o gfRoa60anv!uoW '@ w7;A@z}Fz[$x5=&w@Îu.Ȫ pdzFyw{3䎟3 (B.w1&16u3pPh`mHۈ j#$M%dT!V4*6%-mV|VQnhwr0G+9FgG{̔q^#֛;]L^Pۙ)ddwɝpS,Sxs"M$Xx\Zb{`,2$%p0Im 8HČ߈wԗQrٖ #%U|ۭRLpn5.KUc3*Kb4Vϣy-|.Ղc}M~2ӑCMtA͊ S UvU~a}o;p~0ǻ?L+1bv?@+}"AG2f9KIZ=a "czKy56?Wf-$)6yiY8Cb- BQ#6рTfa]LEn TS!~3s's!~8Z j o|T0xJgԞڊ##IJƖdrYU25d"ou4>#9 c2\I8o7{-hQj kb>|bj M%{@~V\\fr'7dE0Qꊡ5R'm^XoXf ĊWPZ7'F+p:Q&5AL"0A/>*f bRy cM;<=_YZi2mC DXoHhO3cZYqոVmn PK~<bsmmy57ÎhK@.t,jUh磽G;@`|.l센}cn.b2yAk@z A>Z=;{b٦(ۗ >Uܱ YX-gږAqu wE 4 ;igWظF W9yU_EtB1mmѣ/MSa{c0㚕~'M/S1ai?78F:O1G ?Wܵs`U C#}S1p3)s^Ucy ` 3*O*f77cvH92TkʠeLeXL YU6D89'rTvQ!ݡ/0 [zg yߎsC*?vAYrE3HcTޅ_.=/r:/!#E>G1XRԉ׻P΁\kئTõgUHNu*733+N3s>|qAG3MՖ\'O3k _ݏ*=Y3>Q8f}s50A={5s~jKv׭b՛!ˊZ~rt ,T?nBU?B]6Sy9X{o*?z=#_"K#FX{i%Q~';(").+Ѕƻ:1c:qVνgMTUGsL54t7`.O*RcBJx/(E6/9T)Ymo0\oRk5PJ]U(Y.!UD*Cl@}G0bgUVԺVUs\մB'XI2 T%<"ne)?z;A|-ޡ*1A]zk|8sPT,@_~7/x%6Ղ=jUP)߁}zJw j|%o(&dHyzuK7;9@oKZ+>o @N1u[垃8]]@p6K6di" y4Ӥƙ.Qfv*h5``IvLbn%3Ni8㌐*88hBݻ)s&KS911'ɺVK 5[˸WQW/yv b10_;ueR~%`~z G>{Gm}qǞ$uq%3qlܭ'U uY-G:6!#Yو 8y#C(@1ʯv|fc# |BFN}jLMǑv Poy{ U}Q >Y؞rga;x;q ^YwS}+sb=.OJU8 춿x{b*\~z Hd ݃8 qcd+YȺnb͚+ _3{~]Usn\1W HFg+®U"xox8@S)ᤓEᎋmboٛ>+`,}E;,8XY9 ]kq'k2poty@)P:a,aho]r0xw\-f_~=X,} V+BT:ͩ:KX34N34cUJYkIֽ .q`Pڿt =u,¬fcmOoϳ'{"1/7v[siG&º-bd[WR|T,(dUiejkZZA}Y!ǖ*Xmr5ו*u:WFkemqVY-؀X dV.kww;# hڐ6eiiFm֮ujvݡlr7ם.u:wwl3&@;bcǁF K8@(3yPσzX=z`%Sl-6ۈ2aAPMCQkP y@m}Ic V1T8PDEQ#R  !|>_ Ă.h6t@mK-ʃ]j$P,Rxwm5}5k.רVO0KÒe*'\%@9J$Wza텵1 -z-wH( r+Fpƀ{dTOC^kvia5WWOʁdl gH4}6((=,dKp2w.!7z:G<(eFf~Je*%Hp2pG3Q6Euv'2GJMH7)2dd7=gE8%[HUR.2\^NOPNVK@!g<:O'艚"T$:fF[fd-hԌˌM*Ca\9CZ ߣ< )/A?I:EIlA+ݏfz } #!93t Cf Y3 fw<:n'1kć.T5fH$LRP'ur8n%~|◓!ə#'?zF΋?NSyzf7bL~9< Iכ| tq1Th??EBv.?%?n bd7z =k"@mD01$LtI1R}/ƈr*_(;,'#Xxıʱ̱đuwd9}N399tjNթ83+96d,+HSTe٫ !n}:lVT?}դzxYqu1긳OSǠŕIJms~Ŷq;YDR/VG?O")ad8 Hnt&kɣE " H贶خ C OmF:Ji73;h6RWdNy3SԼ?qmy\o~6ph21_NmINafluz"uU8'Bt*9/KL3?9Oo@H)Fh =iMD*9H}nq҂K`cL!M>Oa4V2ɼ@|< _IM$`b>O%)J,@Mq"Ӛnq3ӪyD8Z0^Lb6UDA-Ē_ZG$[abZ$ ZIV+jExIKU=0tMxD,8^zBIو`hd&t!gz;_C~tŷr`TFE>ޙ9񔩚jŒӄ-Gb*M:+4oKrA^ߔ/벋N~Q/ &b`Ky jQ)X)%ʐ]oD1A8(?AA | [Nex@弁qDv3 )o80 P.lRf _uV[\6B.!6hi]s\vyn"07|>F&lݽ̼hܿ[z݁C8u!08?`*CjGҺtWtL"(UOp?d`HcĻL mmv{zdKyɪWwc{lN> endobj 83 0 obj <>stream H\V TTߛ!!2M$(3B4T02"Kp p$qiTĨ1[50TM55h%%5rDBrڤn߽`>z+3q\N=j_'sqna j+M/"wsSvz?pI˗vey&EqSXge;ia㇀KWf8 nryL猜}I[ 7ar K1}XeuSej]S}l|*Q~|°+eX!Na 1t)D5@Z@N٭8%o^1ns _aFPǗb_wcx|q Mi'eb?CPP~Ԣ+GO#ѩ#TES*3v*V#èG<A7qzG;!NGw,IbrTb'N4x=Yba*PM/S1T=Ccq\n';FeX'm~/7Q:Zײss0:7P.yGq7DyQG:ʽ-%@/ hc "/<_*V/#a߆6pIVJv NzR%+LbLlL}3'xB]iNKhTI_UU>V.uR#-N++k1fҳ%˷7Jm,qoCibG h%.q*,.TMEZV.z'ܓiD+n "W UHpBP{[͢%>ԉB(B$4OeUe~y%+FVMj:=S)lG@h R!BZOh):OMׄ~ϲ?s 汜9\oz%"d&pT5Y"RWnu]5Il4Qf´ZHGJ&Sڴttl2GSm=fC*JvP~ETt;thؗ2Tcx\Q*RoEVC_)gTq_x։ߜ80ÍxۘZHE(|G{%M~Oz?g˜ɧ`Z<(hx;Hg2M{^(iC8 }36&:GdDxX{5n]ttzَ~|۷~l5ńmDm{S?;rYh/e\֬61/%D2$~L$Ycplamփ4qLomV׽6>_Ʒ>$D.Xv׈Yv\w-9;65> kȒHm [k^(WlZRaTW kHHflmS\ wunAr)enSc}TXkb-?)Yڦ:'e3UGhkwYJoo+UUu{GIٸ&TB&"M~ J+?m4)B,8hvD6XbIm`#3Xh;QJ*6;w[vC[3s9{{}__kM{p5\ ⏵&oq1@_=%/ԫỳ#>/%\yBwxypM]\k\OMIx_]/ N]N_o%}Hn*$t-̎TI5Rvjw"X f++4 d;?d5±{ai)kE&G_PZZh`s<>~SՇy._.p{ }݊s2|>*C%T5{,|i!=&һ-U%=}w{\>=s愴><;bϟ͟R"*z$*IBYhcBF ɳN4'/LwKNNay{)qf('-`\=νF_P v!y^O^0Ue^l/\O4,J ."j9`N)u>m/ەz]CSZ=嚇kK|DUj( kt.[̰ѹ\zUavt[#~\mЫTKŇ@9FR[jF&gΡF膣_>RKJ<'cf }fg6YDAEDpl57j,GQ#R;c7t!EqV# _OtJY"@Kz6E5hOٹ#?>~w@ Qh32cƸm`=^JakYTgQȒ5 xݼf{MOؾXD}!NçC> db-z+md|:8z*$νF$'h@ _1*`KsBgcè^sзtg2Oof}!gOxoՔ1En,Ԃ[=}VYq| 몌@C7^9#O0baS6EYCu *#  .6}|Zm>~ T/9^#Q9~Zc33qH;ɼ{ghkgnE%s_,7D,-*MJs~͈U䐏n3F ?_Ƙ]y#ϰs 柎c7y*>"q8;ݾ!>QqJ{ =88LT<'ET,F#*M1dT^L2';<&Fhy%!o*o";JRqe!JCR*@퐋{DN@ sxRT~<)+.>S+THs8#@U,(a]v7B/-S>`8E%c  ~OfVh"m4Ԏr)F@l/Czxޏ]}K,hwj9qPI(]QX&[ų4Yl[DC>A}i>h'yLKw P~rZD-< U.ve<5|){[2.E-Hkur^cUmO9D%bkOK9q,xf.ZĈjJ /Z/֫>6|3.os{gZ.|*_ %-4ƨQ $ RHT-Q+Y=>ΘRJVPR>ZEm 7sVQӝ{7ٙex!̖y.&;8KXds dh^RH Z(g܅-cWqkZ,mkg!a/*! ˷H^ݪ˕턾̪tZwEW13m MG/# ]FvQvT]%ʇ}DҔ$ {z3 UMUKnfCw,*q7lo]&-3 G6+q9$_ $c 0 ;3fex%oX"k~rm!L$k#jtjX=7s7]0g0Mެ+uA, 55\4Rp/\؋i兴DZ)-iieiZYVra9!Eha\oz(S.ǔoĔccʧcpL)9=HA\wqa;[{hR4LmQ!iZ]# YkptLHHß|5i ,g.'P?DJq<~՞1w[:,n){Of~%8-Kav>Ls'%GQ5Yizu*إHI(ch |'\z+-1uz( HK{zLw6o lq75cN]4C~>E5Wۣ086m.NMҭݗϐ$i\[ -H+e*ťF9(re+2zr /^iӠ+ED`ӝ,f'Yp| Mc| ϢgbΝAuTu/w[U4ÅC2+^Ņ}:?{"n%G5ɢed`%|[x&0-ES`V]rr˙n~8t21 :u1rOi Q8~0 1vA1Xpz7=:4myyg1_Ə N;eY$FG<.V 7~_q*J~d,(˒0JV=FҚ#Axt?\ լ''kȃd b#U4"G<#z|el]%nؖ  %=+9TFKFͲ3'Z{ xwV[>uV,wAzlRn\k{(&^EBĝ=HE:}B1L׼ VÝZV۠ k{g mV{+v'V{4O+n]|$nU٥$4CNmPB؆tvFvs&m tj#xYhתh$rjjWqU j`v^8I$F]khDZ[b\c㸪8>wf_ޝû]{5zDMi "AX4ƭ IAiS@IG U(RačJvٍ͙Ih̝=g줍<.`bLtv}sAE o=X˃͡ iTOэh="1<?( X"Ub#9Z)ˊ_EYK2LԎSg`yRXYM~NrU[XFawag#&޶q:7e_/pNfPT:^%)a:3B)AM(|w2S$HىaZ4]豢X(0]I{pXh^~I딕Q睍w !$C$QAkc#kIl;l;A-nϡ!ImD̬g+Kb9|<%&uVeJCOCr,BےBHP]E-96F JU),&Q"-e>M2;&Noew4/X&>EewJO ۛ{wz{)f1!r7詌Ni'4<;½CBOO/lھ=4~# ZbsƐ0kz%Hbl8cYaKR(%+FQH$3) ֖W\g! #kO||Wpq~m=dR+ 9c0G$6ZiYFn_,;vOϦ lxklښYut# [Xj>EZ`=~| _g[vw:3$ƣ'0N҈f08:뫩#8miP8(iG96Sx+h8Z{:+ߌreYkpuWV,ծڲe[mR.&[ bs3xZ(Ԧ $$d¤Cӆ6HL.4v iSihLivfEY C3Ѯd:}*m{ܦB4)U_861!ڟyE!&++A`9)qDqUýO}]m&g%4qCIO#t˳޸iq9+pŸ.;tBϷXW<yo~wrOax8n2zApwE0?vZkLՎ SIW>N+TwBJb7ȾБ@RUhE?zϑEe]鸒/RԈjws&9ߟY,Q[̒v3{6򖕥o1?=~OKyfBK3u-% .Jӭ&J-YN@N !)(օ? ^61 ` + TV&dS@ͶriUďYt1rzr\+.UiS+J}UJ{z/hxik[y|_h :aW#AYއX;5ʋY!I "o$ Xne(# ^Ih6y!$qMн(ZrYreK)bn'IbXA"o\?oj-;Jڻ,KK11FBX RgX|F( 38e`ڝ\{:D!4=}ezʅ>_ '|sp\"Y5LuYIDIؐ^Ņ#n<35.aQ(}JS`ͫ at:c ?]{}n__A/@k6y['?c's=:xz ,tP"NF6 /k:5IZpŹΑ:aIi#N9,%r`w%:@t~ktu;7*kk{QM6|~Ç W\yȟv<-nǿqOEITvxBG3b`3Qܽ=OIK\eo4.0^d2 2Mpa 3ɲƽfw>@0`J@c"S {i``=+s8*DFcŰA b1oV=ScPoiAH;p]+^um:Tg RȌ - u0,yLߚϖ$,$IN&1x\K&SB఍Bt.J;Q`B)rDPMSR-)|2.3uHfRr)l;s)LLdfAJXFIO}WQN; 0a2̽ۈ0LȐcg^0o_gu"]lאwŎ?0 P^ S=>)LՋ JcCLhaSMM0 ;:T6``u-xZa[?7u3~ʸ<h+UTGM8mlXV]al$sC]1:vcW_Px7 r/+,1T6?jX_wD7]vJe6Leܢiq:׸C)yi;c)f:#dh^zy9nE+!#,(;,u_,h5IMdXm2$sH.3dwS2NW>Ag@`3,Ϯ /cpA*R.OXi~vvOwu6?|*Lh~[u45n=wwHE9|KF~B><|$FJ(ٽmT+ݡ$r/خezG10Z\UE;Kdոi[:Bj=(Ѥ(ȒD U(GgdtZ&擪(x6b(E}"VG,E K"cKrej{t6"Jj"ڽ$74D$j fI(Y"_: rkDbDg}^ĈvtJF=0\BncW=\D7w8`:=ݼ+_A( 3 ]cPށ]e;;A 3:-LމJsG[Y;/&f*s5'}AX?c>蜖MO΢O\sB Tۢޓsv 5_{5t- ??-]@*tFȽ$yH$itx(&R'M#g Po $"I>?NP(F@+LZ6^A|S"ee塽n|{'qjC*rfP+W<ͯ˿߹+8yiլb {xm;G?ӷ[w ,qK9*5ǧr-l77ߺ}BX?y3\ r34JNXD,'6Z|0`kr[L qSHnuN.*9tQvU}_K:W1Z`@rjU8ZbB"g/;I;yp#o1',,e^.cx}=k[1]s?ʛGS˦/YvF*Ju29{ !zzug [¡ݿlNߎmu ;G{5H[,8]0[;Za=UGSent êb#6eVAnӹ}Zlcj洆_&P9"P:dVHS8u2\wAz&@\*gȔ&*`<+ռQ-۫𾒓@@X+e`$7k+F0D,"jE gt*^l`lǎ/>-+x{7u񽻖֒Vkwmi=klی4@xЉqRhR#$mjg dR0$8Җvә2Si]C,zw%$=WHOr#cg7[ZEWwo3`ulXmvUGs#Uzo?|':A@P;|/ס* ăTeL&/Q(7Tt!4 }"p.1[ n\sF>LqA. 6&_S7x<)Lt✍k/c9l[ץy9v2ڛ/X}dD+Dɬ h4ZGIOɟ ʅ ˦b*F=5#ťjjVe@1V+W)EyD3JV4U1chG,'U{`mQ S} jQFH}^g65 wZwljq Ɇɖ؛7S[o׽W-}M m7o7۹ovjz֞l2umضAqj?Ҿ}*+@"z\2^]޻n(g fbZQtf͙L#Ҏ;9s6uvxL@?hF WRf.V^d6@4ys@,dH!#15ɽ-8wv07s/[1T,J`XYJh27(f-c}+ -W/,..䍰,>,F{IFdYyە2*ٛ!\M GYJ+70&KZo' 7}JU*+J)mMlv+Vn\|R~a@-AYuC_:1YW^m\3:$^\1jZ-NC'v FO5"Im-;w3lfzVJ; >ڴVl.N68nO%bA^ieFϹ{+=Gjg$ -x2fx2Q+ L8q0t\]ϡsn!͐cvwjv95 ^=v0oN$4`(T[d/RON 8NN53 TH8:?DF RNX 9"0u^Dnq!80K/*NTl0Tǫ5ʶDRtQ:1uOճ榆%?0~Pno4^a )ze2`gde8|ZQe=U~ۑDs!QCT M| XiƷaz0LvЄWC9Bph XcG>y;1UB9~jFPȌ\j0H^O3M׭1y O"R+L}$%jT*BgaЄ&#-| Gq6>eL@$"=VBkČKq\VgQ#_J6Sp4٩˓3˗~9{K_\;y\]Rtt;''wUx 4|G \+?L5p&рV6z ڣƅjCb Ve(ɰ ܂٣\o/}+ю!I67&+uUvJ:OO0, @'v]$*Rrnzu .g?eﳟa ;a+J?Gڕ”R ˝߱slE !a|~ Fd^J׼r!y2>C*SMZrDѾUhj>Xéw6q~9|>?ؾvl'}@ q^fPԧ_$Khg0#㿘9<*yۜ"?ەKmGi_ےוpd< T- Q[]Dowd]#J6|>'v}'I>-V4fw"3u_js¨SY]XD2g1Hc-uԁV Zu߃Y]jT<T&ykqٴ&X[[LK?Z6HN Sʦ;?M{g)눵D…ޯQ~*HE~1m< >{~[$MI!T4&h6L5;U,l61ԈCcH[aI qV 9uX ϷBhc=ǫ&$P6W6ގQd($9>Ѧ_%IRZ$R"㭟 Gb 3;XϸK[3fV/I;7PN ]RL&{J 繌qUTqTФmc2c3ep#kxN|l5O7d5͉V.i&ސE+7-X9 S -ķ[,.ƓɘjDYqv @ jgZG_rrdG)U잂`0FnYYKf?]P/ĔL| X01X^'Us?h(.uxL1M٦b@"o䑤z՜H| ˞YTdO$5z6.X!HfO70sfƟ=1[*q4ր;*Ho6ۖAViϙE$vgK%euno>RөHIS% 3*m0"Ym&M]x36z]˫Nf!'Tl?04 J8 V %!^#j{vV<"#\ΊRcJRUM%U "5/ # 6/"3qé 1Ǡ-pAVILѬGö<[|}a4j58:Ɩ?>L6ZsM6-ɂoCgJbVZZGzYfS&}L}E)nIDSpE!HZ*(8x]\Ot@R.G|:6z9зڒOhV(t`R˻XoAg| nt#;Y2{a$ ${3Kbؠew=oa5ҧgbN8{_lt=UnʊOK!{yhnyq1Kۻsj4^8z{ rB%_E K_ | cn}(C/1 u#F z5v8SxԺ+N4Wdj}T4߄cw1!Ns>0O[\km )5l]s'(}G> @fgk[ F6S=$~m]xp]QȪlT{#ڈl3#p5 ka6vsy.Szg/w<1W p+8vP)ѣ":Fc1b]G m^|ݭyH- ϯ6jݼ0旧+n֙| c5"w?Dfq&@BcZ8}{{䞹垻wr@!B#P. U )bjL"T)։xP0* t8^8>~# >e#EС9ŒcqW.gIH=kJkפɫ\U63IjǗqDKϡ!Qz\#k lݤXIrZwns ICHc۹Vv]6l}۠g1l)v/_ aQΟB;NfRT Lx&y7tEO5~Bk>ӨX߮ t™UKC{e%b4 CX Pt(_N!譋ס޺: ^(BXi6; pRl6_;8:־̾~&6)h)Zhj4(GaAC۠JѮ6߹S42н4i۔1MdwMIkF)÷81PE|B|Yj.iDa-5qڵ|Y ɲ'@Ζ˸Nt + tbmvnی^kSBxܐ$DMBc"ϳ#eud~)F%цNsAmvao;,dYK~ w% -͉Do?q=9I<]^4+ L;E%Z(qEVWPkS;!jkÊ!#DG8m i"|ƕD))(g5 S?uw< 1%0d q0XӖSS?>&e#>mkG"zy͚[;k2;Kn,E$X:t ^NqM> }sTZIc!ҰG\(k]{gɮ[⋁3jkV]{ɷ/nԋ#_76r"+yu2D=h c4&sq1A ;p5T[c+mjDTqq , BdyLϴ i%M.߹\6{{zZP1 #B30m\Eߥ?ЫPT'C}A]ϐ熇06&F酩fl6ŭ/ƍr%hz"NQWlQGeOJ b7Ķ'+.CR顸q9U,)#HL)Lmm }"I?4ZW8qpSǰ>}:^Ơ[j7",.z)}v[נo`٤#dHAlycIqFvm) ε7p+Zt-K-2dd玻N'EΥCA`,̪sT2>Qf5p|QN;9{CN3㙅8 W_QnaW:/h1!J()t,lF(OK*oUNFJ6q=w7optDVI3H#AS}ax}cxJ:C~Z'.;3|cct~q>GܥGoޡ 3D354XRe!gE RCP|en\DYĬd`Lz}#>ˈ#dW LQ @I_ 2~d)Q%VJcB,|u@Cbnzkv4xuDgqoW7/M"3IE=wI]W`{Ezά·s, ~.61dJ:U0ך*='m8 i"ENOVARHB3zoZC,(x/cžn@(I4T Bn&+Ž Y_u92U& @vcUU9쿬,Zx҃R Hٱ#M48|Ȟ|-EpzMˡmΨyK]3\큁6Ӻm?)oƎj5Wyk}ݪJyO}99 t" z_g:c勢fi;]Mw>?>/8?^|!-@6]C ZV2D1%Q!IMd NU誖899}K>x0Oq&X މ萣:bRgI=eٞl?K%+e t%'E3Ъ^03࢞?9P}[_<j[}55}|GSqUCr1gGW|5(/5^ !sf,Xz-d:Q.3P]aW':tDd#eG:)^L @R4gh s%IvV^Ľ%,g)ݿsK4:jPr;iCI[fmz?Rfi -U_*|ny!>wo5)byQ_99~tW;~'{Vr EQr OG^NLhVK4xEYF̎Yf6 }su5F}.XSD߀m%'"+ԊfK.z|:{M}MtDUIQtB*%IɁ$%CdԒ듦T~T4Vtq!)(HR@u.EhTM:JaR&TAl8 @(B KȉkX<wp#Zr$/Kɭ HnC>hg#?3 z1h+f@T\D& y :*M̴=ƏŮ.zIc\\d hہ{ŒGMb=E5вj -ZD ԼD^øm*9`"8wݳ[}?] ~:8b8Ĵ #]2NZu9]N'E;6TWaE짉@#dz`ZSTTAQTƻ?2q›\LUx|;៌a.M J${Idz Qa2xqhlc{V5#"H% )rEaB(n%gtG'Fx|4YﮉX| =c:b:]!) W>`}DNMQ|wW۱Dʽ;ۺG|w@a\ewwqw9Y\Wg_/TR;NHjbm4Bz aB ?B}^ jpF3pQϨiQǍ*n0/FɃ~鎦c7M8DX/&}sĂdYf  60iI:s\[nvKv1-E N̘%d6/w p݂1=S(0yv G5Dbq=]Xtnqf8N=qj? N8Z7S9USF=䭦;؉֗9L|ٽV~]c1廾|i&Y78?z'/Cɔ&nut :!~xoh| O7ox}j$=pxC,1^%J`*y<;HǐK>rP c^/wiL˲ Iӎ$U!9Ŵ( Dc0 g_iծ$n &[?rCA.%3HԦ?bӪE= t7GZ轻ZKZVJV۶ddƎ\08mP! @0ƭ:%q-<&0>I M:Hiv 4 ֺ] WwuG_Kel Ǝ@5U- ^^fw5]-ġ#7~5R0-8-[hmD~[\MsүÌg]E!h~W){@- (?-~+`(=(#ѨpqK%(ɻV5x# +幠98q v(J܊Sb,sVL7</n'j WY 6 ~.Cyp>ZL*,kwoZic-w};s>->L`̍#z6з'6'܉x': tl 9B z.9r`$LUԆ@!JcQ!Y0e5+ L2J?9bn{._7RhN^ER;aҺf:q}*x+lb8{t[Q,-x4Z57"@Z"MɅO?~߹U3 Q]E'46YqK49L f''d9wkp^t2)I Ќ@ӌbXRRYBD"o%bc|KC8rT[,1zq SDO-ei7=uu&R#njIpJ廃wm9KAƜBr{@Cuy1$S.* -N:Sv=IΩSԾCC3ԯi]C{Y՚nNmhgvjw/pV;kckUnml\yQ@Z+-;@-/H1XCEde".LQSBRbH5qOE'1QWT rhYV٭x<*S2u@NQ/Q"A@t$:ɪf+Gg+^C م@XN P댰g5e='PYKXyڵ"C|eM[o'ċTfhHynbnXӇlR&f+FT+Q]ix3cx4x5BB4^j W2VZTԁ̨Ͳ}.G2~ՊpU+Z)IqJg2i)xVD 0y>͑8b"uE.m]): Zji=~{t^oW-_oniSwL?ö_]5fkhzt۴3˗0v-=xdAkj޳`;pϾ @L2,T"caknBc-t&7[ޕ ƧĈy$0j5}"ƃd2C"22<>)S-1F F& cB8 Y)/ybaN#آ7qP5 x=<bB{`Aba,? >D?I'$Gr8$p75tC:|J&; ѓR8hc8L>:|9A:5~H=LN>[_}VR>w[*x֧]5괟jǨwpڐh,Ew(+OK;Uv K/^t^^3e?=O_0~ߵw$]<"rUq"A)&]hb)$51Ш .b7(ᦦ)cBH!-R?*I+ jJ۵ i̷}}si];i `ï'4V蚚 QY &JEpD )Ɉt`Y}[oOx-4!Q*$)KжK<[H$KNIFy**E&n| r%6pKZ4C22(CT ïQze2ha("fiG>ՠ҆,f&w6_Lsl2u7o:o /638숦GX7cPQ y3ਫ8Hy6oz&q%}rKrrsX>V_;l!r%78JCq?@jYu7U{mLE"h&eA"I tIrѕ_eMf`P9$ilW;1W$UY! ՙR#zXlM![X>fIXM]^t'[2=Z{Ѷ¾b~c^B hű^}!E[{GP_"ۗHN?/>QnٕBT뤹ˁuN:yh:hc2Yx0`V=;!m;i|o#]HW6?S)Ҵ6|tРۛohL~`_0*Zfs4+*NS-f*Ѱº~'/oMV~/-bs_qh㧮>'#k^k_]~-+mKSH4xn][d4\ X-K[Cҙ957 A6RI%bl3F n7`آ5FrD IJdj+QJ2LR5T)Ϟ-zqLD-2| KDH^:y Lo톆&,y ɦܧ*=͗dLs ?XZTakBq]q a3,\&=.yRE~Jܧ0Jdxu4vOPQrJF!E^Yip7Xƫ#,CS.F&׋^U~l qԚmy.EœA[[o)SᗖhU s|o8D*{*zrǟ[ Wz*wܞ+AXZː>mD qQXuZ!P BRlKnaUtXmvscr#0 Ns0jMIn&VTp^Vґ$Y11:.24MYn^1hN=lS,>BdjFݨ:Te<ͨpȳ9 ;S $ p$oǂ)JtsMJWYHWw$ziGe<ҾVYs/7n?sp a٢֚]'s'`xٮ9;|nqEQԢR4ZRJ5999NogfOj7q8ERt(0NMag&>ul`,65NM\7Z[S)j+K+~jO;a(48uwҩ3j_%H,-0ZBIylEPANW"! S) F$R-ܣnm>rv|glj}v>>ؘrҖP^‹GW6҂1EЖJhAf +JA 64҆?I_fvǝl'~>L E2iZe9&H!V]eT.9Q~ýqsi qRDΑ$yl==cJSVn R.=ܽyo/MŔ!"r&<(q%pcjytTӥ"NL7 SQp(׽eLfYsY80L҅/fǕ w~d/Y{uQ|^Bg澸s /`KkM>U^#ԧڹaz5%CvR7a wK_gsj>_XP+klm)woh|x"{򜾬_q2Q,]5k\QְiDM9 GXgT*&L>Lj:)15>)?\Ӭ7)u%:}N*"7ѡg1g,2?=~iaLgoYi؛$CzS^/i}vq6И%eڪı5^geX\*Up;QTXaUT]qk-9T "YIPW8PgwOk\K1]UAADI<hdX/MEҮۗC 6/ -󻌁U@^uSk+o.J08~Z$ vq~PgL=.CI,kFxc î+=6T:' D=٫&.m-% /}oϦ$!36{xw+ʱz˥į/gRkw߱R?"SzׅXu5Km<~ڼUG`jXWA>YIP r9=.*!%Qk%XgUIr5Z+|`m֌2ԜTrbF᪨Llk ݎ,9:D5orMDAEw (isn\E l92mfDcʐB)E3UQzlco53 Sʢ y%˶bܗok D͔J╯`.k Uتg麸wԙag~Ԟ~"'ntXPM3[QMo-N\Ԃ +'o4Ea>䜎Ƒy L~)ȩ6Z6yH֝MJ)Kh<YJT3S DiU M6-$`sy8R5j5t*.,ݗjT*T$i*ANQTDJj4:B$h;aEog7BP *q9w1ah Z:k-բz$U:'Bݮi˺Nzn-jWǼ< N)xߗ7|Ȱv7~Yc ?WN( ntiz5QFX@a#!7K}CaאLQ38g%u|}7 V]J,H,6SWJLHj4xYXqgxqɦAexpW+&w?_x  66>l7;UzyέZ dt``PEb+\jD*Xd,Q:dDבб菻\8su$UŸDz┻V {#bԫP/tvJ>;*}]oQo׻Rц)n{)#ij a}W!485N:CKg:@f%Jz4,`f-0YX;@CS.±GM IS)OT/%\HEI&fyAp?:<ƚ*|`ihBz1iE:YoؼVڶl״cJZpP*'ږ6ґyqұ6vMñ@qmU#]'8&[(.E;IHy5JY'@u 7OZQqȿ ٳ,ׁ '/z׹ӓ`K$^)]Y~T=HkCʭ Nyy8Zq8Vi:9:=!2b8%#"#BFqis@'X V30shW^pA>(K0hE(l6 V Z9jHSPb/0 o_p| "'A1@EʢlCDm Q/#b\& \! Br$d$W\ߕȴjxd VP!/@B@\ y*d r*dr* Tȟ%X_"b*;bB]8[!YIsv 6j_YΊ|o0U@ʢ Ku?lݫCnjswo ܊[E$OHIbN|,J FCBH'䒿E'>G3r&r3"h D3Y4B}u>pvyHF[i/? pFVB!NI:1DK`#GD)UdZ3V)pXIԇ,YjQ3r ֲ,L;ʖRA0X][l6z3U8'663 9+`0HHʓIÏ&FŸX1L#bȲ?M,.Eh3g}qhcs7P@$Jc?Lqk?={Bqogiޓ{VT"&ˈ7iH󿡭cxM쟟~%mWhGUDi!m=fAodJiTQbTНqG2_Öu}g Ӎ&Sܗtjc,dZu}+D/AAjBpA P]ؠjP7htEzioQ1jxujO*wQbq(!N\!yP"P< 2γxc 8r'֋ <֯B*}߂W=՝+17r111_+BpƬVH=dSAZ$KYB&N#/Z/. DNRJʼwS]]q=%M>{qdYQxp;[=>>xe%6۫#*=YgQ%2M~ hUzm6"3[399ӷ uvLK F?d>?xDOO~9Ŝ(@-C}AmѭL6Ie+]FM/W I֙yyuy++"kO%gs}$EZ޵rv9hmXI\q,ڨJ̒T'DQOKΤf> :i;~߇>-+0%˿#c1MEy: :5v IvR,IYF1tSH ڕXdc2!ڱw!;I&;I2IYd'= ;I&;)Kv%;)KvdwC=tj9p&OLX#f#IPxjF鯮-O5M4.ץ 9^0Ez4Z끩mAÖzk<mɑ{I.XcK!'**EsL.-sBZXЕ2ZnGOnOF2ِBcbۼ~UpNCR+q h2y`9zp4cVPal Ć"j:͎Nh0ҙ13g$'~gv{! D$ v&(h=+|N J klxi&gfʯ#YAUvu#|­Ժyj3;y2ZO=? /h/Z ITőW~+F%kPKComImQh w֎~`$T>M"\!zM `O;DW|/o,[@Ъ G"n!hr8Zw i!^N"dJDp TAP U  X+$BH&L f%l!񔬨bRʈ ivQEixBLJ5_gɝz|R(L?5ٳ.4Y Ʈ%o}F.LczշBNwTӑ|&ykvZ {na~kgm,h+Lk8[UP>Xr*Kb$J&WU= +ƒC>HؓP;M&&Q_Hi]J=s9n5&o$MNoy?Gz-Aju`^Krƒ\Rf-2!h S9 H0C 7Ę"0Sm;R+PԀk w-LC|<\V&bB/m۾D_cSQO;#ˉ=P̪?mX޻꫆]0?v4ttQ!*A5뚩j;jj WBwT?~;s;m(x9x#8ubmvnXkhIzZIt810mP23"*KhD@a!MKPWO +UE\ SRu\qܠ{;w^>y-c7~^<ʧ^X^׈>Ӽش8&KIUeĖo\v`]]+xU1AU|y",0#FAPNRinq*0Ӝ˝L iF4cCH/?16tv߆߉fyeHE/+7yﻳ#||gǾw~$qHNHc#<'6qŀQW0d- d1ڤH !UhUtSN[uZ̾;'~}>[~8 /b|86I mTn-㐙fk`P3w\ru8~OnlJ Vo<^}1v#w¥FKM.7W ~vv eߎiɴ̲Eifo%l#[5RR39h5pVeQØpI+3l5b# QYOˑ[w{֋OϪb{[ǟj?mjpgYU5ЧOz!)@pT389Ō5hM0F[PkVׄz`FDEX% QMaX{,}~7h*Qb eF@p6$0/ ix$vy'46ц%YI4^|!i%IwQ?}sKK.ppʧLvzF—RI[)l43p| CP7`.,;ۏETK Z%Ρ1_u5Y\3MZ UG7W6}vϹݵ> 75ꃡ7{z[+纷. R)toى|r o~ѥ)Ș '%Z?x7;LPb,\me:`3NL:yi[otZ=Nǥny#$ ں@&/U%0T6 ' vN6QpS ׈ Yh2i,S:$c(]8Dw-{~Nxrz݌ UYHԋdJdoUlP2v+Ԅ__ 7ru cYTeFG+EY1IE2BJ\eq!%@ SNw)ČFh  :jB|G9M :x ,Bzt˴Re5@7xKAU+5~ϭ"kjݿrQ(g=%;^zs+)ÚKq]Rػw(|E|G|~`Ci9b6 ;\dx@K%'hٞbS˜prs]'d~s ԝhJ=˞pw?AGS𾣴 VPEP `lEPl(a{=Wj(dt3h=t`fpfZfD(P 2m}= L( -~A-hF:/ݒ"RN@.k>۝@KY'ӤC\5+\9sJbv[Rbl\u8+j{jF#E8aKzc$%JWpanIk|u7.Qܨfu. h906Y\9n >kPĩIv#\iN.# _P`^8}ƞBS*TmϨ}3>2ϲB]t=xH`B{ ="x`B J1*/T)SWY5l]'J{"q.fv^IJ[R.MziCdntW0l@+LDS e9Ga}0S__i3g?44Wyο@;5WD*/I wAH$mu(I[ܭu.mv8B!L\>Ͻ<6wg9;c7[ d!$I+,u˒AB逵#P7hQ*@tEc[UhUպI͞l'e݆c_l~ǸX 2,sa XwIvH +`P!bDVp»r]r#rmXKQX<"DP#JXXH7 A KBxqCrTXޅBMC 26.%M 2`>'1N]*nǓ,{:T˧ׯOxcM'8c{nJWo6ew)S v]ȼ]́m:3ީd~J{G2q-j}2=|GeL̪2KIFKK.E ;4q؄CTIT"~#y 6葛~CMhp.͚鈲,mj2( x~eNa,bu#wsFX /)uNUERǗ rLuw$*a[?M+ qۣkqn7 rA -R0}l6'pg.;}@WM8^}g/RaA뗅7uzxquN[+hE;]=SNwV9c^:b (:9I(Rjkv۫StavUk֓)f:^G&Ͷa۬5owwڹ`d0Tƹ6`fts N,$i^-䜁XWN`vvdC,jЪ:40\:DRUxrx\b (ymm+`h\GĆ*8g!AlB?kG5FuFuFuF|44%kTk_^c 3l}P֑ 5!kx\`*t%GJ7NPm(}.NA.4yiƤuz@S>)z ǻeVsfLm-i7̝&9$NpKYz[}V#?2t0`l}DZ@)>g@a|^쓏~n-~^Y]!{&!vRDS(!2zdrFa-_y C?_S#{Oo_"hM'(Z >דzw6D"|L/C[j>#!I%OM<ÞI0ݜSm?Q.!u \|Ƿ5 +dl[DW }:=)=ՌO¬}^c/('44ؿb;<77~oL}mLޘ=1k2Ro+?pԃ~zܷzTb2Wvأx]~f}tĬw9,k~49YzA2L_s0:"Ik!жݱBϸSWi^b\jvzh=6Z^_OFJYrXFH? _ B Gqc\ ޑ㢀 SK 6)âfq-śfI]2V~Iu?Co>Tz>`G$UwU;r<`͖ENao{?f_'_K~-]پx݇{40a!"VYĎAq$y6' - {HM@;]0՘b pfBg0tzd(nzlhc("b;Aq 熣FI SA}jf)}WUbmMnlYiV1zG$9W` z-aɲISq_+™cg⑊g*<˖+12hvRPKSuW(ttJPb_jظln{cׅ3ooX[#W}Ui)yn^uU[KoU$FfOiw@i;u  r>Lʖͩ 1#dO2yD{I&QH0Jf]Af(>R MIQ"Nlu~h[2O>-hCGEEl^MǤ,/ [ٿ-gN߭#O+ߓ?]ɐUm PX;Kl4%Yk 6p9J hVkiXЌA/-eES5k^`aHӃH6l aSͳcrqЕmOꍺ]k[i2uz-y\u7T#_Fԗo[O6d6vڧm swVVXk;eecM96!Xnz[ A@Q@N#,H"S1F 1C!&1Q~) `\,f|}}y>o,ɑ"y6GsL iiOȫt7Zu9Ց]ن,6-e糝e`p ɹJjx.WDRsk'aɔŠҁOK!{"ہzwkpjdps09r*N?Q}s7_ X8 Ÿ?_f <yAwo 7|9OTA7C).0CԎ-Bwa#xAgOp/j=[F pD^ޅK> o9 Xۏ'Zy@gPUG$չDMWcsjWF-y>!/x'Naa`uDO!`ț=͠lwa^ͨU6{_1sxgvB{*&z 9o%ўo¾Jۏl/C|h`kxѡmG^x-ϛ]b+3/38m(ˑ@Ѧ9ΠǑvpuYi\. oxu9Zaŋa4|.7}@ _x_B c>I1xbUF| ޣ 6X@'S(x SfPdDU[~sULݪΟQ#z]UPs<շY:Lwa_4 rYi0-GnSnvv}}O 4nH1(eho0db DMlI'_if2F¬Q E$MT ji  byWE  yRRPp.S 㐕D\Er: f1хU梟F51tJiԷjܵ+F~85>& endstream endobj 84 0 obj <>stream H?`]0 XYY]@9`IB@"$ ^ 7a 7I <w@/U, #X6#{?m@g endstream endobj 85 0 obj <>/Height 157/Type/XObject>>stream &xj xc!+QHln3A Y1<]?? endstream endobj 86 0 obj <> endobj 87 0 obj <>stream H\V tW>oT̓<o}Ab.2F[zm*+vܷRfڴ"`-+(),qDdtOEI_$׿HTX2-*.-2O8uzF$_,vx]%ۦ93{dـ/~WJ%/)zCRf#ȸ:#t9vwJݫ~?°Kx)_p SPL"Raի$ Nq2[@}Lou0b`&"/B1_`.وXU_!EFG#%5Lċ9XBIhŇ2|{m (.N3*YnF=G zlU8b0sޏg~!Vb QO(19|)E1^<]jlq`^*}.V gpE*j{wò;Nq`]fF.4Rejk-ܧܗuvXa^G]\c2ȋA20T*B,';>#uTJgٗT~k[U:Yoч[.ђ 26|zQ|{ALUTG|h6{znh+yeI> 'xB](^*G^'V):jkL6˖L]^GJtrv?M`/\|E8{p@|{&_ A4hͣeg:iTZY'Z7{}r咻;=G':[үzޮkuRp7He@Ox)!\xKdİpXw _۞YbHv#|4 f{ ZCki=51:M稑.H1?܋͕ToXh#*/䫙d\hyq*}tC|m6U4WFJ=inQ˸ (zWH^'ud^]筪yP]4n7fec,U[ kiNЙ1ƈH+T+u09Y^ҋjIqg=XV R&Dߣ(eRI(-bkJo"] ȫf;sm<3E4,]u†(TihϚ& J88aqۧw1Q=Gڻ؂ ڥs_;߶m|ZLC1!:>< uֹ) _,l46.[k$,?ˤ,gI~$DR6 ݶefÞcs}Go+zHlt,r\kKq U8%!x'ۓcQ#h@{I&Gu ┫ݑdwzRa)IGh%'`j1A%e\c{5T/뇉Qjyᄋ1X%)R"Ѻ@UB]LlcM5jƤ&@Y5E)qT$֢QSwbۘΔs9{{}q_P=R1`ߥݩbL&@N\ VI[T1WOr1Z~p祄5Ǔ|w>ϼ|?#!KO"m!gaGЭ(;{ħ&2TU}ẛțZli- Re["w/W@+%=OϜyA1 fz9y1=+bJ}"QJzPV0$Ҙ+bryFsÿE]SH^^JfN?Sq/. ఑]bl;@ǝJC  kkyZ6تӄZzzW[=W|_jWO-\< L]ʔX%RVC)T}vH#s:f.^𗦞Kȡ'\f{ 1Z%F5*JeQMLۧum^- 0RN2t#/G-E2 LG'cxcc }J r'p,,|8a6z:y,ǍEQ- R; cx݌E/.~b uGY1Pf ?e$<XGC G!^(OnAAi{(m=h; P[Ȥuz&L]#zY~kפt0.Fؿ;|s@ҮF:-0ca8ܫ@QN8K#PgS7 [ d=Au#a>y}ۨPMdE2ד.>q46cMOǞqŽ5kY8 h7E5(y |l/jjn >L1bg2_kanʷž5̱іsg@%u ?Fu_5vs9cKGy+Kw(vVD1;r+Ma٬8۔qNKThq}-8>ؖ9.# >:b94ﱱ^WR/eJYNX;m g65b?h0Z5Ӭ6Ѭїsnv[hۗ/?4kMQ#jJifۖUPWU* /e^pUNAh֨uZQ̥H+<>\˶]\N|TwqՒz6}sga7"܌~Tގ33/y[8sn0.&_G8pwAć*P}Gi(zTţ4{g|9KvS8SFZZdW^8FqKvOW= M1UYA|"ÜG;><\2A6&[qKmq4y|VJ1XhdLi&=ػ,&!_q!i]04WVQws"!z+W!2o~#R)2h(1໏8XZX2޹F4`c[8v2FaAm(APoQV@zFq\񙝻ًk}s.Ƌ?ns3>bL*_mBCA `&JAD~hJxԪR@RU"I+뛹kQ{عogl-e ֈ_Ϳ\@AOF%6l2iX9@Ӽ̘%q QIfII E3I h)@v_|. Z 7A<И,Hąry0BN8$zUV͸2n!#d0:#gqSg-<ǘ "aÛt"h㐅a--`Z G'\`ך.ð 7"ˠf{>2yݨGB穥n69G~Vm3Î+ 1[cu2!E,ŠJU$0Yb*3H؇]Z3j&çjQãeP.դe=CzI}Su.FmϲWk f[u]&ٍT Y>ZNYST(&/Yʻ}݈FIQLzYm߶giKg!%Oi`0\xxaḧ́7> D3`c(,Sɋ0)y~t2h3uFH39˫A%Z]q TIH{rR I2IBI;5dxO!t ^9А /{Y=&q;ppCkI lacT$X! J aE2:u$*/Fǣr:*o_ˣrsTNNDP4\z$(姃׃hP HF}\wp4^8W>TJ4d2C[PhQ- 9I/`NXyx i [ y K5&7XJ*5:MЕktEx+`@hEca^W[sВe 42A]ƿF">[mbF#).U bH>iT&y%IH. RU.ӂFUi Lb[%v%I ~;rb~ݭ쒵F0~%SWQ+Ap{m~l+)-|+цγCur,l:Z0}h:?Ǖ {_`/5h0oj&(n499}6vxu5HL0u{qmg 3Oc1܏SkG$ԟ^}WyPq@%\O~J ۥ~u_/n)=`AFsu\,]stfE`./=.|`J` üܙ[ȟ1"5>>>6o] uG4-inHI}(e@PbҶ hlLq>^x׾S>c,aHswzMwpJ19hU0V rFn$M&vAnAp]B`ܼ/ C+DW>Ħ؈g,wò _p>,9yĜݪDnA^5Qq?-ymx.ZEqx̓t4V4V`BA2;o'(蚅ÿ#Qj!YaІB*E./UՊ <UҰKUS)w(Y-ť%Kzuhߖ={[ }w0o_^ԦK}q}{3ҁlS]4b] h3Cdz~n"%1 /11`D5iZpC[HB6Ю;d;@h?'.xOPA:2܈KN+q'ߋ՝:J 4X*1ݏ 8;8qhw2Y K$)Ҧ!zG51Jq^QH6<+iyİj(|- $s+|H:#2ghgL6&*-Xu^Nl&JC  = ͹fK~\mnZ/s S%b$[^0_dt %-mX^Mpd?`J+Q"yAmF,a *[M5iZ4%m£jui.yʾ = ?K;ñ]iW}o\p{W%c &_;z@=_ 苽 endstream endobj 88 0 obj <> endobj 89 0 obj <> endobj 90 0 obj <> endobj 91 0 obj <>stream HdV l>8?I1!G$Ia(# # @Pu- JPh`j !`VTh-VN*1ZUmwM`=s}=~ P [y k#{>u@9Gf>9Z:[KŹG {pn ڽVd@4ځL_||zo\;Q@5lUK3,ho̬"H߇񎕙S˾(Zf-损Rchoh`!ay@N}NUUpE&]vQ#%_A_QJEff+k-嶲>% g`GDdsB)M^G>+2F_CI'pd!"釷gwh\bI#%d94|"FNʲ(GҎ M3TϞ4s7_Ox& ΀L8pekf/t7LP/kacՙK"͡ǚBbnlC"8+0Gq Dnh/q7mƮC3&G"]aD;5aFy:<} ǡFҗ}etoBε!OsJpʗ AƦq]i a> AK4O^2C*Q}zsy3IM#=1 q&[sI BMՒ4 "܇kQ4p];qшcX8'qf>XWvl|(D#։sc_0$AAYvvXQ_6uSy2/PoTʰ~O@~-¢,">#[^&7sr7t,ԛ?!y}XS΁|1t?xa[.|k6B'QZ~<3y}ȫ{ ^'=+x"ATXIáDxK8GFZ4RRR1q ]#dZe-b!KG'fcQR!˄,"-\VY)UL6ۅ.<!BD[!"J}B!d)dEkqO\Wl197wrd/A?5RɒL]r$᪐˵&}kx2PaVҪa"K!FU%D )/Ds& g Ni@bX51?P޸|6$nI4? vWI ’y!cmP^/ 5HԎb? D6?!~< &M!uAG#fSXfvU|eܯ*n*VLH=BMn%rT_Nj͊AgU@uKrٜwIC Yì8!AXlmgl]AxxZ7 ]hܧ]0F׌ГdY{*^19#sH{26&{AK e%hTakQ]5E)6RJ8&7j(3GMX$3.EILNۗ*) #қ]$>"<^hgf1 bIѠBIVڰ)&;H 6ltFGUgESPIb/_[q4oϝϿݳGnFn?3|pg[fT>ݮSgaj BreHKLt%KŪ%8CƖܮXdGPuU5$v7˿rjbt]GW-{~ƉiǶ[(%ڽc?Zm6<{S1dgGXǓߘ'+* iE:.L*.05CB楘HZYK&ȗ8KI>QC6 Xq]gzs~Ύto_-&* g ea,,p3+hlYJIT!"u7 e ZV41R&R5M6Mė@^7323q8zrM(I4yxYKZq_NWg3a|C>v6J&*}.V^eWhY4Cٕw4vsAĜ(-~!]k,+⁷kUCD;Ԃ4PL3H iۙ^|A̵JX%UM-{X:|nIz ,<ɷs|~?GXhi=uJ_s ̎|(-7cb;~WӦ^>w̶'{tѠ c3lYᒒ(想C{;&EnMk^3!()*5Q*D+/VeP \HV;0%n;rδH,*M,ĥM͐R6]󓓟K?~멓[᫗b@cz,ux)lm|ͼzK?2CeS/L inbf́d */"'OmL)N1DkQHIW9-FZTZdmu_ ) X`;[~cϤ&Gו:TR"TN5IH$K%5X*k*PMX |Vzy3w*ff*( Xc*_PxOǿWǷgP%Nm@46oT B$  w bMM_7]`o啧Q>"Ckn[c7i pgK_޵? 혥о*x֊OiىC4Q aFB۵=Ԩ\DC=\Rd[:3j~(!ٻJ'mz%Y2T5 endstream endobj 92 0 obj <> endobj 93 0 obj <> endobj 94 0 obj <> endobj 95 0 obj <> endobj 96 0 obj <> endobj 97 0 obj <> endobj 98 0 obj <> endobj 99 0 obj <> endobj 100 0 obj <>stream 2009-06-04T12:05:17+02:00 2009-06-04T12:05:09+02:00 2009-06-04T12:05:17+02:00 PScript5.dll Version 5.2.2 application/pdf Microsoft Word - Muzikologija2008-2.doc Janja uuid:8c7cdede-f5cf-4720-bef1-b1027fccc6c3 uuid:e22df5c5-f978-484b-a970-a08b16d93899 Acrobat Distiller 6.0 (Windows) endstream endobj 101 0 obj <> endobj xref 0 102 0000000000 65535 f 0000199733 00000 n 0000199921 00000 n 0000200044 00000 n 0000202839 00000 n 0000203027 00000 n 0000203173 00000 n 0000206157 00000 n 0000206345 00000 n 0000206480 00000 n 0000209605 00000 n 0000209796 00000 n 0000210003 00000 n 0000213038 00000 n 0000213942 00000 n 0000214133 00000 n 0000214269 00000 n 0000217279 00000 n 0000217470 00000 n 0000217605 00000 n 0000220945 00000 n 0000221136 00000 n 0000221271 00000 n 0000224757 00000 n 0000224948 00000 n 0000225083 00000 n 0000228473 00000 n 0000228664 00000 n 0000228811 00000 n 0000232387 00000 n 0000232578 00000 n 0000232745 00000 n 0000235809 00000 n 0000236000 00000 n 0000236211 00000 n 0000238100 00000 n 0000278747 00000 n 0000333006 00000 n 0000360023 00000 n 0000360214 00000 n 0000360446 00000 n 0000363647 00000 n 0000365467 00000 n 0000367096 00000 n 0000367287 00000 n 0000367533 00000 n 0000371109 00000 n 0000374491 00000 n 0000377513 00000 n 0000380871 00000 n 0000381062 00000 n 0000381267 00000 n 0000383994 00000 n 0000385781 00000 n 0000387819 00000 n 0000389360 00000 n 0000389551 00000 n 0000389742 00000 n 0000393072 00000 n 0000394545 00000 n 0000394736 00000 n 0000394928 00000 n 0000397275 00000 n 0000398785 00000 n 0000400553 00000 n 0000400744 00000 n 0000400903 00000 n 0000404392 00000 n 0000404583 00000 n 0000404742 00000 n 0000407636 00000 n 0000407827 00000 n 0000407974 00000 n 0000410718 00000 n 0000410909 00000 n 0000411031 00000 n 0000416805 00000 n 0000417078 00000 n 0000417221 00000 n 0000417386 00000 n 0000418240 00000 n 0000418829 00000 n 0000427666 00000 n 0000427926 00000 n 0000470009 00000 n 0000470274 00000 n 0000470592 00000 n 0000470764 00000 n 0000478230 00000 n 0000478503 00000 n 0000478757 00000 n 0000478974 00000 n 0000482355 00000 n 0000483547 00000 n 0000483637 00000 n 0000483714 00000 n 0000483789 00000 n 0000483889 00000 n 0000483984 00000 n 0000484079 00000 n 0000484174 00000 n 0000487925 00000 n trailer <> startxref 116 %%EOF