Author(s): A. C. Flores-Gallegos | F. Castillo-Reyes | C. B. Lafuente | J. C. Loyola-Licea | M. H. Reyes-Valdés | C. N. Aguilar | R. Rodríguez Herrera
Journal: Micología Aplicada Internacional
ISSN 1534-2581
Volume: 24;
Issue: 1;
Start page: 1;
Date: 2012;
Original page
ABSTRACT
Invertase (B-fructofuranosidase) is an enzyme used in the food industry, where sugar mixtures are preferred to glucose because they are sweeter and do not crystallize easily. In this study, a biochemical characterization of five fungal strains isolated from a Mexican semi-desert (Aspergillus niger GH1, A. fumigatus GS, Penicillium purpurogenum GH2, P. citrinum ESS, P. pinophilum EH2) was carried out. Evaluation of maximal growth of the strains on potato dextrose agar at several temperatures and pH values, as well as the assessment of invertase production using polyurethane foam as a non-biodegradable support, were performed. The highest growth rates corresponded to A. niger GH1 (0.2831 mm/h), and P. citrinum ESS (0.1931 mm/h). The maximum invertase yield was 81,270 U/L per min, determined for A. niger GH1 at 72 h. Oligonucleotide primers were designed for amplification of sequences from the invertase gene, InvF 5 ACGTCTGGCTGTCCGGTGAC and InvR 5 ACCGAACCCAAGTACTCAACGCA 3, showing an optimum annealing temperature of 61.6 C. DNA fragments of about 560 bp were obtained and sequenced, corresponding to the putative invertase gene of Aspergillus.
Journal: Micología Aplicada Internacional
ISSN 1534-2581
Volume: 24;
Issue: 1;
Start page: 1;
Date: 2012;
Original page
ABSTRACT
Invertase (B-fructofuranosidase) is an enzyme used in the food industry, where sugar mixtures are preferred to glucose because they are sweeter and do not crystallize easily. In this study, a biochemical characterization of five fungal strains isolated from a Mexican semi-desert (Aspergillus niger GH1, A. fumigatus GS, Penicillium purpurogenum GH2, P. citrinum ESS, P. pinophilum EH2) was carried out. Evaluation of maximal growth of the strains on potato dextrose agar at several temperatures and pH values, as well as the assessment of invertase production using polyurethane foam as a non-biodegradable support, were performed. The highest growth rates corresponded to A. niger GH1 (0.2831 mm/h), and P. citrinum ESS (0.1931 mm/h). The maximum invertase yield was 81,270 U/L per min, determined for A. niger GH1 at 72 h. Oligonucleotide primers were designed for amplification of sequences from the invertase gene, InvF 5 ACGTCTGGCTGTCCGGTGAC and InvR 5 ACCGAACCCAAGTACTCAACGCA 3, showing an optimum annealing temperature of 61.6 C. DNA fragments of about 560 bp were obtained and sequenced, corresponding to the putative invertase gene of Aspergillus.